For educational purposes only. Consult your physician for any health problems.

*These statements have not been evaluated by the Food & Drug Administration. This product is not intended to diagnose, treat, cure or prevent any disease.

The role of R-α-lipoic acid as a cofactor (lipoyllysine) in mitochondrial energy metabolism is well established. Lipoic acid non-covalently bound and exogenously administered to cells or supplemented in the diet is a potent modulator of the cell’s redox status. The diversity of beneficial effects of lipoic acid in a variety of tissues can be mechanistically viewed in terms of thiol/disulfide exchange reactions that modulate the environment’s redox and energy status. Lipoic acid-driven thiol/disulfide exchange reactions appear critical for the modulation of proteins involved in cell signaling and transcription factors. This review emphasizes the effects of lipoic acid on PI3K and AMPK signaling and related transcriptional pathways that are integrated by PGC-1α, a critical regulator of energy homoestasis. The effects of lipoic acid on the neuronal energy-redox axis are largely reviewed in terms of their outcomes for aging and age-related neurodegenerative diseases.

Keywords: lipoic acid, dihydrolipoic acid, energy, redox, AMPK, insulin, mitochondria, PGC1α

Introduction

Lipoic acid (1,2-dithiolane-3-pentanoic acid)—first isolated and chemically identified in 1951 by Lester Reed and colleagues⁽¹⁾—occurs in the R- and S-enantiomeric structures, only the R-form being essential in biological systems. The discovery of lipoic acid led to an unprecedented interest in basic research because of its role as a coenzyme in energy metabolism and the non-covalently bound form as a modulator of the cell’s redox status. The biochemistry, physiology, and pharmacokinetics of lipoic acid as well as its effects on several disease states have been extensively reviewed (see Ref. 2, 3); the diversity of effects of lipoic acid in a variety of tissues can be viewed within the realm of antioxidant activity, metal chelation, transcriptional responses —related to inflammation and induction of phase II enzymes—, and cell signaling responses, especially in terms of cardiovascular function and glucose metabolism.^(2,3) These effects of lipoic acid can be mechanistically accounted for in terms of thiol/disulfide exchange reactions that modulate the environment’s redox and energy status (Fig. 1). The energy and redox components are integrated into an energy–redox axis; hence, on a mechanistic basis, lipoic acid co-regulates both components in the several subcellular compartments. R-Lipoic acid—as a micronutrient and a therapeutic agent—stimulated interest in clinical research because of its therapeutic implications for the metabolic syndrome,⁽⁴⁾ diabetic polyneuropathies,⁽⁵⁾ and neurodegenerative diseases (with emphasis on Alzheimer’s disease).⁽⁶⁾

The Cell’s Redox Status

The redox environment of a linked set of redox couples—as found in biological fluids, organelles, cells, or tissues—is defined as the summation of the products of the reduction potential and reducing capacity of the linked redox couples.⁽⁷⁾ Quantification of thioredoxin, glutathione/glutathione disulfide (GSH/GSSG), and cysteine/cystine redox couples—termed redox control nodes⁽⁸⁾— brings new dimensions to redox systems biology; assessment of these major cellular thiol/disulfide systems in different cellular compartments indicated that individual signaling and control events occur through discrete redox pathways, thereby leading to a new definition of oxidative stress as a disruption of redox signaling and control.⁽⁹⁾

Lipoic acid—either as a dietary supplement or a therapeutic agent—modulates distinct redox circuits because of its ability to equilibrate between different subcellular compartments as well as extracellularly. As such, lipoic acid is a critical component of the antioxidant network because of its ability to regenerate other antioxidants, such as vitamins E and C, increase intracellular GSH levels, and provide redox regulation of proteins and transcription factors.⁽¹⁰⁾

The extracellular thiol/disulfide redox environment (determined by the cysteine/cystine couple) has been reported to modulate cell proliferation, apoptosis, cell adhesion molecules, and pro-inflammatory signaling.⁽¹¹⁾ Lipoic acid may modulate the extracellular redox state inasmuch as dihydrolipoic acid is involved in the reduction of cystine to cysteine, thus facilitating rapid uptake of the latter into the cell through the ASC transport system and, consequently, its availability to stimulate GSH synthesis (Fig. 2).^(12,13) Cellular transport of lipoic acid occurs probably by several systems, such as the medium chain fatty acid transporter,⁽¹⁴⁾ a Na⁺-dependent vitamin⁽¹⁵⁾ transport system,⁽¹⁶⁾ and a H⁺-linked monocarboxylate transporter for intestinal uptake.⁽¹⁷⁾ The cellular reduction of lipoic acid to dihydrolipoic acid is accomplished by NAD(P)H-driven enzymes, thioredoxin reductase, lipoamide dehydrogenase, and glutathione reductase. Erythrocytes take up and reduce lipoic acid by glucose metabolism; subsequently, dihydrolipoic acid is released to the extracellular milieu, thus reflecting the activity of disulfide reductases.⁽¹⁴⁾ This phenomenon was observed in several cell types;⁽¹⁸⁾ 3T3-L1 adipocytes, however, possess a low capacity to reduce lipoic acid and most of the intracellular effects in these cells are due to its pro-oxidant function.^(19,20)

R-(+)-lipoic acid (as lipoyllisine) is present in both plant and animal tissues only in small amounts, thus its bioavailability is low;⁽²¹⁾ however, lipoic acid is now available as a nutritional supplement: the human plasma pharmacokinetics of R-(+)-lipoic acid (administered as a sodium salt to healthy individuals) revealed that R-(+)-lipoic acid displayed high plasma maximum concentration and area under the concentration versus time curve values; the study reported negligible unbound R-(+)-lipoic acid at the highest achievable plasma concentrations.⁽²²⁾

The intracellular redox status is usually determined by the GSH/GSSG, thioredoxin_reduced/thioredoxin_oxidized, and cysteine/cystine couples⁽⁸⁾ and their ability to reversibly modulate cysteine- and methionine moieties in proteins. The participation of R-lipoic acid in thiol/disulfide exchange is the basis for its redox modulation of cell signaling and transcription: NFκB-, MAPK-, and PI3K/Akt signaling as well as transcription factors.^(23–29)

The Cell’s Energy Status

Lipoic acid is an essential cofactor for the E₂ component of α-ketoacid dehydrogenase complexes, exclusively located in mitochondria, e.g., the pyruvate dehydrogenase (PDH)-, α-ketoglutarate dehydrogenase (KGDH)-, and branched chain α-ketoacid dehydrogenase (BCKDH) complexes. The former catalyzes the oxidative carboxylation of pyruvate and plays a fundamental role in carbohydrate metabolism and bioenergetics (Fig. 5), for PDH bridges anaerobic and aerobic energy metabolism, and it is the entry point of carbohydrates into the tricarboxylic acid cycle as acetyl-CoA. The latter is a regulatory control point in the tricarboxylic acid cycle; the activities of both PDH and KGDH is substantially decreased during aging and in neurodegenerative disorders.^(48–50) Lipoic acid is reduced to dihydrolipoic acid by dihydrolipoamide dehydrogenase, the E3 component of PDH and KGDH. PDH activity is regulated by products, nucleotides, and reversible phosphorylation; lipoic acid supplementation increases PDH activity in hepatocyte mitochondria and it inhibits the pyruvate dehydrogenase kinase (PDK),^(51,52) hence leading to a lower phosphorylation (and inactivation) of PDH. The mechanism of PDK inactivation by lipoic acid is not known yet.⁽⁵¹⁾ 4-Hydroxynonenal (HNE) inhibited rather specifically KGDH, which accounted for the inhibitory effects of HNE on mitochondrial respiration;^(53,54) the inactivation of KGDH (and PDH) was ascribed to the electrophilic attack of HNE on the reduced lipoyl moiety covalently bound to E₂ component of the complex). Lipoic acid at the E₂ of KGDH is glutathionylated upon treatment of mitochondria with H₂O₂; glutathionylation of the lipoiyl moiety is reversible and appears to serve as a transient protection against electrophilic attack by HNE.⁽⁵⁵⁾

AMP-activated protein kinase (AMPK) is a sensitive cellular energy sensor⁽⁵⁶⁾ that supports ATP-generating catabolic pathways and decreases ATP-consuming anabolic processes by post-translational modifications and modulation of gene transcription (Fig. 6). AMPK consists of a catalytic (α) and two regulatory (β and γ) subunits, the γ subunit being the center of allosteric regulation (stimulated by AMP). Enzyme activation requires phosphorylation of a threonine residue by LKB1 or elevation of intracellular Ca⁺⁺ via CaMKK. The effects of lipoic acid on AMPK differ depending on whether its action is on peripheral tissues or the hypothalamus⁽⁴⁾ (AMPK in hypothalamic neurons integrates signals related to body’s energy metabolism). The different roles of AMPK in neurons have been critically reviewed:⁽⁵⁷⁾ depending on the experimental model, AMPK may function in a neuroprotective role or be harmful for neuronal survival or act as an autophagy mediator. AMPK is involved in transcriptional pathways that control mitochondrial function through PGC-1α.⁽⁵⁸⁾ The phosphorylation of PGC-1α protein⁽⁵⁹⁾ by AMPK at Thr¹⁷⁷ and Ser⁵³⁸ appears to be a requirement for the induction of the PGC-1α promoter. Also, activation of AMPK was shown to enhance NAD⁺ levels in muscle cells and induce Sirt1-mediated PGC-1α deacetylation; apparently, PGC1α phosphorylation by AMPK facilitates the subsequent deacetylation by Sirt1.⁽⁶⁰⁾ The energy status of the cell is also related to activity of sirtuins,⁽⁶¹⁾ which—among others—can deacetylase PGC-1α, by means of which Sirt1 controls mitochondrial biogenesis and function.

PGC-1α is a transcriptional regulator of mitochondrial function and biogenesis and, as such, a critical regulator of energy homeostasis and integrates several transcriptional pathways driven by mTOR (Fig. 4), AMPK, and Sirt1 (Fig. 6).⁽⁶²⁾ Lipoic acid was reported to increase energy metabolism and mitochondrial biogenesis in the skeletal muscle of aged mice by increasing the phosphorylation of AMPK at Thr¹⁷² and expression of PGC-1α.⁽⁶³⁾ In this report, lipoic acid also increased the expression of GLUT4 (as observed in other cell types), but it decreased the phosphorylation of mTOR at Ser²⁴⁴⁸.⁽⁶³⁾ As in the case of Akt-driven signaling, AMPK phosphorylates AS160, thereby facilitating its dissociation from the glucose transporter vesicle and preventing the inactivation of Rab-GTP. It remains to be investigated whether or not AMPK is a preferential pathway of lipoic acid for the transcriptional activation of PGC-1α (opposite to mTOR) in tissues other than skeletal muscle.

It is well established that aging is associated with a loss of mitochondrial function and insulin resistance. In brain, there is an increased activation of JNK (bisphosphorylation) with age as well as its translocation to mitochondria, thereby blunting the activity of pyruvate dehydrogenase.^(48,49) In muscle, AMPK activity—of significance in the regulation of energy metabolism and maintenance of energy homeostasis through PGC1α—is also reduced as a function of age;⁽⁶⁴⁾ whether its activity also decreases with age in neurons remains to be determined.

Lipoic Acid and the Neuronal Redox-Energy Axis

Pharmacokinetic studies on the distribution of orally administered R-, and S-lipoic acid from the systemic circulation into rat brain tissues (with consideration of the transport efficiency across the brain blood barrier) showed blood endogenous levels of 0.05–0.27 µM and brain levels of 0–0.024 µM after either a single or chronic oral dosing at 50 mg/kg;⁽⁶⁵⁾ the authors concluded that lipoic acid does not readily cross the blood-brain barrier, thereby questioning a direct effect of lipoic acid in the central nervous system.⁽⁶⁵⁾ Despite this, there is a myriad of reports on the effects of lipoic acid on improving mitochondrial function in aging and neurodegenerative disorders. However, few studies have investigated the mechanistic implications of lipoic acid in terms of PI3K/Akt- and MAPK-driven signaling and transcription (as in peripheral tissues referred to above).

It is widely accepted that loss of mitochondrial function may be an underlying event in brain aging and neurodegenerative disorders, such as Alzheimer’s, Parkinson’s, and Huntington’s diseases. Loss of mitochondrial function entails a reduction of the energy-transducing systems partly due to oxidative/nitrative damage. From this perspective, exogenously administered lipoic acid has been considered a mitochondrial nutrient. Mitochondrial dysfunction inherent in the pathogenesis of neurodegenerative diseases is aggravated by downregulation of cytosolic glutaredoxin-1 (which helps maintain mitochondrial integrity in terms of VDAC redox status) and is recovered by lipoic acid.⁽⁶⁶⁾

The properties of lipoic acid that help improve age-associated loss of cognitive function are elevation of cofactors of defective mitochondrial enzymes, such as PDH and KGDH, protection of enzymes against oxidative stress, and enhancement of antioxidant defense systems through the activation of phase II enzymes and an increase in mitochondrial biogenesis.⁽⁶⁷⁾ The amount and activity of PDH and KGDH are decreased in Alzheimer’s disease,⁽⁶⁸⁾ a finding that might be partly explained by the higher susceptibility of mitochondria in Alzheimer’s disease to autophagy.⁽⁶⁹⁾ PDH activity is decreased in post-mortem tissues from Alzheimer’s dementia and vascular dementia, but R-lipoic acid (not S-lipoic acid) appears to stimulate PDH activity only in vascular dementia.⁽⁷⁰⁾

In aged rats, spatial and temporary memory loss was associated with loss of brain mitochondrial function as well as RNA/DNA oxidation in hippocampus; these effects were partially reversed upon feeding animals with a combination of lipoic acid and acetyl-L-carnitine.⁽⁶⁷⁾ Age-related changes in synaptic function (in terms of impairment of long-term potentiation (LTP) and glutamate release) were reversed by dietary supplementation with lipoic acid (entailing restoration of IL-1β and tocopherol levels to values of young rats).⁽⁷¹⁾

Chronic administration of lipoic acid partially restored the age-associated loss of mitochondrial function to the level of young rats (in terms of activity of complex I, IV, and V) and improved oxidative stress markers.⁽⁷²⁾ A combination of lipoic acid and acetyl-L-carnitine was suggested to delay the loss of mitochondrial function associated with aging, restored mitochondrial ultrastructural changes, and increase mitochondrial biogenesis in the hippocampus.⁽⁷³⁾ Chronic administration of lipoic acid decreased biomarkers of oxidative stress in young and old control mice and a transgenic mouse model overexpressing the amyloid-β protein precursor without having an impact on end-point amyloid-β load; however, this reduction in oxidative stress was not correlated with an improvement on cognitive behavior (Y-maze performance).⁽⁷⁴⁾ Conversely, a combination of acetyl-L-carnitine and lipoic acid partially improved spatial and temporal memory in an ApoE4 transgenic mouse model.⁽⁷⁵⁾ Dietary supplementation with a combination of several micronutrients—among them lipoic acid—improved cognitive performance in ApoE-deficient mice.⁽⁷⁶⁾ Lipoic acid also improved survival in two transgenic mouse models of Huntington’s disease.⁽⁷⁷⁾ Interestingly, dichloroacetate—an inhibitor of pyruvate dehydrogenase kinase, which phosphorylates and inactivates PDH—also increased survival in these two transgenic models of Huntington’s disease showing improved motor function and decreased striatal neuron atrophy.⁽⁷⁸⁾ Hence, the protective effect of lipoic acid on these models of Huntington’s disease could be partly due to its inhibition of pyruvate dehydrogenase kinase (as reported in⁽⁵²⁾). A recent study concluded that short-term supplementation with lipoic acid and acetyl-L-carnitine is insufficient to improve cognition in aged dogs, and that the beneficial effects of the full spectrum diet arose from either the cellular antioxidants alone or their interaction with lipoic acid and acetyl-L-carnitine.⁽⁷⁹⁾

Lipoic acid protected cortical neurons against amyloid-β or H₂O₂-induced cytotoxicity and also induced the expression of Akt (and the downstream Akt signaling pathway).⁽²⁶⁾ Pretreatment of cortical neurons with lipoic acid (and in combination with acetyl-L-carnitine) results in the activation of the PI3K and ERK1/2 pathways and the inherent neuronal survival;⁽⁸⁰⁾ lipoic acid also protected against 4-hydroxy-2-nonenal (HNE)-mediated oxidative modifications in cortical neurons.⁽⁸⁰⁾

Concluding Remarks

R-α-Lipoic acid, a cofactor for four enzyme complexes exclusively located in mitochondria, is essential for energy production and the regulation of carbohydrate and protein metabolism. Lipoic acid is synthesized in vivo and it is almost entirely covalently bound to the E₂ component of three α-ketodehydrogenase complexes and the glycine cleavage system. Hence, it would be expected that only trace amounts are available from dietary sources. However, when lipoic acid is supplemented in the diet, it is readily absorbed and present in all cell compartments and extracellular fluids where it acts as a redox modulator and antioxidant par excellence.

Although known for more than 60 years to have potent effects in biological systems, lipoic acid studies have been hampered by the inability to detect accurately its presence in tissue samples. A study of the plasma pharmacokinetics of R-(+)-lipoic acid revealed that maximum concentrations were reached within ~30 min of administration and had a short half life when administered as sodium R-(+)-lipoate to healthy human subjects. Therefore, due to its very rapid metabolism, precise sampling times are required to establish an association of lipoic acid concentration with function in cells and tissues. Nevertheless, the redox modulating action of lipoic acid on signaling and transcription exhibits remarkable promise. Future studies are warranted to elucidate the therapeutic effects of exogenous lipoic acid during aging and age-related diseases, with emphasis on Alzheimer’s disease, of special interest to the co-authors of this review.

Acknowledgments

Abbreviations

References

Articles from Journal of Clinical Biochemistry and Nutrition are provided here courtesy of The Society for Free Radical Research Japan

At a ceremony hosted by The Bronx Museum in New York on Saturday, April 20^th, local singer songwriter Joseph RiverWind was named the Musician of the Year at the Taino Awards.  This was the fifth annual Taino Awards Ceremony; each year a council of elders chooses accomplished members from all the Taino tribes to honor.  Each year the Taino Awards hosts an “areito” which is a gathering specific to the Taino Indian people and culture which includes sharing food, songs and dances.  Other categories include Elder of the Year, Artist of the Year, Filmmaker of the Year, Storyteller of the Year, Poet of the Year, Humanitarian of the Year and several more.   The emcee for the event was La Bruja “Kachianao” who is known for her music and poetry performance appearances on MTV, The History Channel and HBO’s Def Poetry Jam.  The event was also attended by Joanne “Nani” Morales, the current reigning runner-up of the Miss Indian World contest established by Gathering of Nations.  Morales is the first Taino contestant to place in the renowned tribal talent and beauty competition.

Cherokee County resident Joseph RiverWind is a leader in and tribal member of the Turabo Taino Indian Nation.   Together with his wife, Laralyn, they performed “Ready for the Storm” at the award ceremony.  Joseph, who is currently studying to obtain a master’s degree in Biblical Archaeology, was also instrumental in the protection and restoration of valuable tribal items which he and his wife presented to Roman “Guaraguo Rix” Perez, an active Taino Chief currently residing in New York City and involved extensively in public education programs concerning his tribe.  The following day, he and the RiverWinds presented cultural songs and dances together for the Earth Day Celebration at the Salt Marsh Nature Center in Brooklyn, NY.

For more information about Joseph RiverWind’s tribe, visit www.tainoindiannation.com.

2013 Taino Awards Recipients.  Joseph RiverWind, pictured far right, front row.

Joseph and Laralyn RiverWind perform their acoustic version of “Ready for the Storm” at the 2013 Taino Awards in the Bronx Museum, NY.

Jerome Sarris^1,2, Katherine H M Cox^2*, David A Camfield², Andrew Scholey², Con Stough², Erin Fogg², Marni Kras², David J White^2,3, Avni Sali⁴ and Andrew Pipingas²

Citation: Ji L, Tong X, Wang H, Tian H, Zhou H, et al. (2013) Efficacy and Safety of Traditional Chinese Medicine for Diabetes: A Double-Blind, Randomised, Controlled Trial. PLoS ONE 8(2): e56703. doi:10.1371/journal.pone.0056703

Editor: Jianping Ye, Pennington Biomedical Research Center, United States of America

Received: September 11, 2012; Accepted: January 14, 2013; Published: February 27, 2013

Copyright: © 2013 Ji et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: This work was supported by grants from National Basic Research Program of China (973 program, No. 2011CB504001), National High Technology Research and Development Program (863 program, No. 2006AA02A409), and Guangzhou Zhongyi Pharmaceutical. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist. Several authors have received speaking honoraria from several pharmaceutical companies as follows: Dr. Ji reports receiving consulting and lecture fees from Eli Lilly, Bristol-Myers Squibb, Novartis, Novo Nordisk, Merck, Bayer, Takeda, Sanofi-Aventis, GlaxoSmithKline, Roche, Johnson & Johnson, boehingeringelheim, and Guangzhou Zhongyi Pharmaceutical, and grants from Guangzhou Zhongyi Pharmaceutical and Bayer. Dr. Q Li reports receiving consulting and lecture fees from Eli Lilly, Novo Nordisk, and Sanofi-Aventis. Dr. Tian reports receiving lecture fees from Bristol-Myers Squibb, Novo Nordisk, Bayer, and Sanofi-Aventis. Dr. Y. Li reports receiving consulting fees from Novartis, Novo Nordisk, and Sanofi-Aventis and lecture fees from Novo Nordisk and Sanofi-Aventis. Dr. Guo reports receiving consulting fees from Novartis, Sanofi-Aventis, and Guangzhou Zhongyi Pharmaceutical and lecture fees from Sanofi-Aventis, Guangzhou Zhongyi Pharmaceutical, and Novo Nordisk. Dr. Y. Gao reports receiving consulting fees from Novartis, Sanofi-Aventis, and Guangzhou Zhongyi Pharmaceutical and lecture fees from Sanofi-Aventis, Guangzhou Zhongyi Pharmaceutical, and Novo Nordisk. Dr. M. Liu reports receiving lecture fees from Eli Lilly, Novo Nordisk, and Bayer. This does not alter the authors’ adherence to all the PLOS ONE policies on sharing data and materials.

Introduction

Treatment of diabetes mellitus with Traditional Chinese Medicine (TCM) has a long history of more than 2,000 years in China [1]. Diabetes has been described as “Xiaoke (wasting-thirst)” in Traditional Chinese Medicine [2], [3]. The classic symptoms and signs of “Xiaoke” include sweet urine, dry mouth, thirst, polydipsia, polyorexia, polyphagia, emaciation, and fatigue [4]–[7]. Evidence for glucose-lowing effect of TCM is based mainly on animal studies [8]. Large-scale, direct comparison of TCM and well established allopathic glucose lowering drugs in terms of safety (such as hypoglycemia: one of the most common symptoms during treatment of diabetes) and efficacy has been lacking [9]–[12]. In addition, there is no evidence if TCM has any additional benefits compared with western medicine. One of the major difficulties in studying TCM is the standardizing the dose of TCM in large scale and long-term clinical study.

In China, some diabetes medications are compound preparations of Chinese herbs combined with allopathic medicine such as glibenclamide. One such widely used preparation is Xiaoke Pill [11], which contains 0.25microgram of glibenclamide per pill [12]. The herb components include Radix Puerariae, Radix Rehmanniae, Radix Astragali, Radix Trichosanthis, Stylus Zeae Maydis, Fructus Schisandrae Sphenantherae, and Rhizoma Dioscoreae. These were selected from two ancient TCM formulas for Xiaoke – “Yuquan San” [13] and “Xiaoke Fang” [14]. The selection of those herb components for the treatment of diabetes was based on theory of TCM. Prior studies published in medical journals in China showed significant improvement in diabetes symptoms in favor of Xiaoke Pill. However, the efficacy and safety of Xiaoke Pill has not been evaluated with randomized, double blind, and placebo controlled study.

The Xiaoke Pill is produced with modern pharmaceutical technologies, which ensure the equal quantity of each herb component and glibenclamide in each pill. Therefore, this medicine is suitable for study the efficacy and safety of TCM if controlled properly by glibenclamide.

Evidence-Based Medical Research of Xiaoke Pill is a 52-week, multicentre, double-blind, double-dummy controlled clinical trial to assess the safety and efficacy of Xiaoke Pill compared with glibenclamide alone in patients with inadequate glycemic control and stratified into two groups: newly diagnosed drug naïve patients, and patients treated with metformin for at least three months.

Methods

Ethics Statement

The protocol was approved by the Ethics Review Committee affiliated with each study center, and was implemented in accordance with provisions of the Declaration of Helsinki and Good Clinical Practice guidelines. The full names of each ethics committee were listed as follows:

Ethics Committee of The First Hospital of Hebei Medical University, Ethics Committee of The Third Affiliated Hospital of Peking University of Traditional Chinese and Western Medicine, Ethics Committee of Sichuan University West China Hospital, Ethics Committee of The First Affiliated Hospital of Chongqing Medical University, Ethics Committee of The Central Hospital of China Aerospace Corporation, Ethics Committee of Peking University People’s Hospital, Ethics Committee of China Meitan General Hospital, Ethics Committee of The First Affiliated Hospital of Guangzhou University of Traditional Chinese Medicine, Ethics Committee of Shanghai University of Traditional Chinese Medicine, Ethics Committee of China Academy of Chinese Medical Sciences Guang’anmen Hospital, Ethics Committee of Beijing University of Traditional Chinese Medicine Dongfang Hospital, Ethics Committee of Zhongshan University Sun Yai-sen Memorial Hospital, Ethics Committee of General Hospital of PLA Second Artillery, Ethics Committee of Peking University First Hospital, Ethics Committee of The Second Affiliated Hospital of Chongqing Medical University, Ethics Committee of Nanjing Hospital of Traditional Chinese Medicine, Ethics Committee of The Second Xiangya Hospital of Central South University, Ethics Committee of Shanghai Jiaotong University Ruijin Hospital.

All the participants provided their written informed consents to participate in this study.

Study Design

The study consisted of a screening visit, a 4-weeks run-in period, and 48 weeks of follow up (4-weekly) after randomization. Patients deemed eligible at screening entered a 4 weeks run-in period, reinforced by diet and exercise recommendations, to achieve an entry plasma glucose level between 126–234 mg/dl (7–13 mmol/L) and glycated hemoglobin level between 7–11%. At the beginning of the 4-week run-in period, we gave the patients diet and exercise recommendations according to 2007 China Type 2 Diabetes Clinical Practice Guidelines. At the end of the run-in period, according to the protocol, we recorded if the patients control diet and do exercise or not as we recommended. During the run-in period, it will maintain the same normal dose of metformin for patients treated with metformin. Eligible patients were separately randomized to receive double blind and double dummy mono therapy(drug naïve group, n = 400) or add on therapy (metformin group, n = 400) with Xiaoke Pill (Guangzhou Zhongyi Pharmaceutical, Guangzhou, China) or Glibenclamide tablet (Tianjin Pacific Pharmaceutical, Tianjin, China). Of the 18 participant centers in China, 6 were located in TCM hospitals. Statistics Analysis System (SAS) software was used to randomly divide the subjects who have been determined as eligible through screening in the run-in period (Details of Randomization and Blinding were in Supplementary material).

The study management committee consisted of 6 academic members who designed the trial, and one sponsor representative. Data were held by School of Public Health, Peking University, and were independently analyzed by the Queensland Clinical Trials & Biostatistics Centre, University of Queensland.

Study Population

Through a protocol defined screening process, 1076 patients were initially screed and those were deemed suitable for inclusion in the study. Patients with type 2 diabetes, aged 21–70 years, who met the following inclusion criteria were recruited for the study:1) Drug naïve patients with body mass index (BMI) within 18 kg/m²~28 kg/m²; 2) Patients who received treatment with metformin at a stable dose ≥750 mg/day for at least 3 months before screening, with BMI within 18 kg/m²~35 kg/m²; 3) Stable body weight within at least 3 months before screening; 4) Poor glycemic control with fasting plasma glucose (FPG) between 126–234 mg/dl (7.0–13 mmol/L) and glycated hemoglobin (HbA1c)>7.0% at screening. Exclusion criteria included FPG≥13 mmol/L or HbA1c≥11%, more than 3 episodes of severe hypoglycemia within 6 months before screening, allergic to sulfonylureas or their ingredients, treatment with glucose-lowing agents other than metformin or insulin within 3 months before screening or with exogenous insulin for more than 1 week within 3 months before screening, a history of heart disease within 1 year before screening, a history of abnormal kidney function or serum creatinine levels reaching the upper limit of normal, alanine aminotransferase (ALT) or aspartate aminotransferase (AST)>2.5 times the upper limit of normal, suffering from acute or chronic hepatitis, hemoglobin disease or chronic anemia, or underlying conditions that could lead to poor compliance.

Treatment

Metformin doses for patients in the metformin group were maintained by single brand metformin tablet (250 mg/tablet, Beijing Union Pharmaceutical Factory) provided by the study group at enrollment dose levels throughout the study period. The starting dose for Glibenclamide was 1.25 mg/day (half glibenclamide tablet), and for Xiaoke Pill the dose was 5 pills per day. Following the label of Xiaoke Pill, the maximal daily doses were 7.5 mg/day, and 30pills/day, respectively. Study medicines were adjusted every 4 weeks according to FPG levels: 4.4–7.0 mmol/L – no adjustment; >7.0 mmol/L – addition of 5 pills of Xiaoke Pill and/or half tablet of Glibenclamide; <4.4 mmol/L – reduction of 5 pills of Xiaoke Pill and/or half tablet of Glibenclamide. Dosage titration was at the discretion of the investigator, if poorly tolerated.

Clinical and Biochemical Measurements

Vital signs and any diabetic complication were recorded at every study visit. Anthropometric measurements were taken at baseline and at each of the 13 follow up visits. HbA1c for preliminary screening was measured at participating centers with National Glycohemoglobin Standardization Program (NGSP) certified methods. FPG levels were measured by glucose oxidase method every 4 weeks at participating centers. HbA1c, urinary albumin-creatinine ratio, immunoreactive insulin, C-peptide, high-sensitivity C-reactive Protein (hsCRP), adiponectin and lipids were measured centrally at randomization and 3 monthly intervals. HbA1c was measured by high-performance liquid chromatography (Ultra2 HbA1c Detector, PRIMUS Corporation, USA, normal range: 4 to 6%). An immunonephelometry method was used to measure urinary albumin-creatinine ratio, C-reactive protein, levels of low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), and triglyceride (COBAS Integra 400 Plus System, Roche Diagnostics Ltd. Basel, Switzerland). Immunoreactive insulin and C-peptide were measured by electrochemiluminescence immuno assay (Elecsys 2010 system, Roche Diagnostics Ltd, Basel, Switzerland)). Adiponectin was measured by Enzyme-linked immunosorbent assays (ELISA) [15]. Liver function tests, complete blood count, urine routine assay, kidney function test, twelve-lead ECG, and physical examination were measured or performed at participating centers at recruitment, 24, and 48 weeks after randomization. All study drugs were withheld on the morning of testing.

Scoring of TCM Symptoms of Diabetes

TCM symptoms of diabetes were evaluated blindly at each visit in 320 study subjects (80 in each treatment arm) who were located at the TCM hospitals only. The symptoms included dry throat and mouth, lack of strength, polyphagia, polydipsia, shortness of breath, vexing heat in the chest, palms and soles, palpitations, insomnia, yellowish urine, and constipation. The questionnaire-based scoring of TCM symptoms of diabetes (Table S1) was based on the modification of “Table for quantitative grading of diabetes symptoms” [16]. Each symptom was graded into four categories and assigned a score from 0 to 3 (3 = most severe category).

Safety and Efficacy Outcomes

The objectives of the trial were to assess the safety and efficacy of Xiaoke Pill compared with glibenclamide alone in patients with inadequate glycemic control and stratified into two groups: newly diagnosed drug naïve patients, and patients treated with metformin for at least three months.

The safety and efficacy outcomes were incidence of hypoglycemia and the change in HbA1c level at 48 weeks respectively. Secondary endpoints included the changes in fasting glucose level, proportion of patients with HbA1c<6.5%, time to reach HbA1c<6.5%, and, β-cell function, insulin resistance levels, fasting lipid profiles, and the TCM symptoms score.

Safety Assessments

Safety and tolerability were assessed through the analysis of adverse events, laboratory evaluations, and vital signs. Patients were counseled regarding the symptoms of hypoglycemia and requested to immediately perform a finger-stick glucose measurement if any symptoms occurred. Hypoglycemic events were classified as ‘mild’ if the patient had symptoms or a self-measured capillary glucose level (CG)<63 mg/dL (3.5 mmol/L); ‘severe’ if the patient had symptoms with CG<50 mg/dL (2.8 mmol/L), and third party assistance was required; “nocturnal hypoglycemia” if hypoglycemia occurred between falling asleep in the evening and breakfast.

Statistical Analysis

Xiaoke Pill was regarded as non-inferior to treatment with Glibenclamide only if, after 48 weeks of treatment, the upper limit of the two-sided 95% CI for the difference in mean HbA1c change was less than 0.4%. A sample size of 400 patients was estimated to provide more than 90% power to test the hypothesis that Xiaoke Pill treatment was non-inferior to treatment with Glibenclamide in each of the study groups, assuming a 20% early discontinuation rate, and an expected inter-patient SD of 1.2%.

The primary analysis was conducted in the intention-to-treat (ITT) population, with supportive per-protocol (PP) analysis [17]. Twenty five imputations for missing clinical and biochemical measurements were performed using multiple-imputation technique based on Bayesian MCMC method [18]. The highest proportion of missing data on longitudinal measurements was only 4%. To account for center-level clustering, the study centers were included as random effect in all regression models. For normal continuous variables, mixed linear regression models were used [19]. Mixed-effect logistic regression models were used to analyze categorical outcomes, with adjustment for baseline data. The ‘unstructured’ covariance structure was used for all mixed-effect models. The primary efficacy end point was change from baseline HbA1c at week 48; end point analysis at week 24 was exploratory. Difference in the estimated marginal means between the treatment arms along with bootstrapped 95% CI was estimated to draw inference on non-inferiority. The proportion of patients with hypoglycemia was analyzed using a generalized binomial model without adjustment for covariates. For the comparison of hypoglycemia rates, generalized regression models with zero-inflated negative binomial distribution were used.

The insulin sensitivity and insulin resistance measures, and the study doses were analyzed with the use of generalized mixed-effect models with gamma distribution. The symptom score data were analyzed using non-parametric quintile regression, with treatment comparisons at median levels of the symptom scores. All regression fits were bootstrapped for 1000 times to obtain the bootstrapped standard errors. Time to reach HbA1c<6.5% was summarized using Kaplan–Meier estimates. SAS 9.2 (SAS Inc.) and STATA 11 software were used for all statistical analyses.

The protocol for this trial and CONSORT checklist are available as supporting information (Protocol S1 and Checklist S1). Trial Registration: Chinese Clinical Trial Register number, ChiCTR-TRC-08000074.

Results

Study Characteristics

The patients were enrolled between Dec 20^th, 2007 and Oct 17^th, 2008. 1076 patients who met the inclusion criteria were recruited for the study. After the end of run-in, 800 patients who still meet the inclusion criteria were randomly divided into the drug naïve and metformin study groups (Fig. 1). The respective mean ±SD ages were 53.7±8.6 and 54.7±8.8 years. The median (IQR) duration of diabetes in metformin group was 3 (1.0, 6.3) years; based on Mann-Whitney U tests, no significant differences were observed in the baseline variables between the two treatments in two study groups (Table 1). The total numbers of patients who did not complete the study did not differ significantly – 16.8% and 18.5% in Xiaoke Pill and Glibenclamide arms, respectively, within drug naïve group (n = 65); and 13.6% and 16.3%, respectively, within metformin group (n = 55). Demographic, anthropometric, and metabolic characteristics of these lost-to-follow-up patients did not differ from those who completed the study.

The glibenclamide doses per day were similar in the two treatment arms during 48 weeks of follow-up (Fig. 2 I&J). The mean ± SD dose of metformin was 1140±340 mg and 1130±360 mg, in Xiaoke Pill and Glibenclamide arms, respectively. The baseline distributions of HbA1c and FPG were similar in both study groups (Fig. 2 A& B, 2 E & F).

Outcome in Drug Naïve Group

All safety analyses were done on the ITT population. Patients in the Xiaoke Pill arm were 38% less likely to have any hypoglycemia compared to those in the Glibenclamide arm [OR (95% CI): 0.62 (0.42, 0.94), p = 0.024]. The average annual rate of hypoglycemia was 24% lower in patients treated with Xiaoke Pill [Rate Ratio (95% CI): 0.76 (0.49, 1.18)]. Patients in Xiaoke Pill arm were also 41% less likely to have a mild hypoglycemic episode compared to those in the Glibenclamide arm [OR (95% CI): 0.59 (0.42, 0.82), p = 0.002, Table 2].

The maximal reduction in the mean HbA1c level occurred by 24 weeks and then increased marginally for both treatments (Fig. 2 C). The mean change from baseline in HbA1c at week 48 was −0.70% in the Xiaoke Pill group and −0.66% in the Glibenclamide group (Table 2), with a between-group difference (95% CI) of −0.04% (−0.20, 0.12). The upper-limit of the 95% CI for the between-group mean difference met the pre-specified criterion for declaring non-inferiority of Xiaoke Pill to Glibenclamide. In PP subjects, the between-group difference (95% CI) was −0.16 (−0.48, 0.16).

At 48 week, patients were 31% more likely to reduce HbA1c below 6.5% in the Xiaoke Pill group [OR (95% CI): 1.31(0.81, 2.13)]. The proportion of patients with HbA1c<7% was the same in the two treatment arms [89 (48.4%)].The mean (95% CI) weeks to reach HbA1c<6.5% was 29.1 (26.4, 31.8) and 28.0 (25.3, 30.8) weeks, in Xiaoke Pill and Glibenclamide arms respectively. At 48 week, the significant reduction in the FPG level was similar in both treatment arms (Fig. 2E and Table 2).

A significant reduction of total cholesterol by 0.28 mmol/L was observed in the Glibenclamide group (CI of between-group difference: 0.02–0.54 mmol/L). The symptom, as evaluated by the score of TCM symptoms of diabetes, was lower in the Xiaoke Pill arm with between-group difference of −0.96 (95% CI: −2.08, 0.15).

Outcome in Metformin Group

Patients in Xiaoke Pill arm were 24% less likely to have any hypoglycemia compared to those in the Glibenclamide arm [OR (95% CI): 0.76 (0.43, 1.35)]. The average annual rate of hypoglycemia was 62% lower in patients treated with Xiaoke Pill [Rate Ratio (95% CI): 0.38 (0.20, 0.71), p = 0.003]. There was no significant difference in the incidence of mild hypoglycaemia between the treatment arms. Eight patients reported nocturnal hypoglycemia in the Glibenclamide arm, compared to only one in the Xiaoke Pill arm.

Maximal reduction in the average HbA1c level occurred by 12 week (Fig. 2 C). The mean reduction from baseline in HbA1c at week 48 was 0.45% in the Xiaoke Pill arm and 0.59% in the Glibenclamide arm, with a between group difference (95% CI) of 0.14 (−0.12, 0.39)% (Table 2). The upper-limit of the 95% CI for the between-group mean difference in change from baseline in HbA1c marginally met the pre-specified criterion for declaring non-inferiority of Xiaoke Pill.

At 48 week, 20.1% and 18.9% patients had HbA1c below 6.5% in the Xiaoke Pill and Glibenclamide arm, respectively. The proportion of patients with HbA1c<7% at 48 weeks was higher in the Xiaoke Pill arm [89(47.1%)] compared to those in the Glibenclamide arm [77 (40.5%)], and mean (95% CI) weeks to reach HbA1c<6.5% was 31.1 (28.3, 33.9) and 30.6 (27.8, 33.4) weeks, respectively. The significant reduction in the FPG level was similar in both treatment arms (Fig. 2F and Table 2).

Significant reduction in LDL-C and triglyceride levels, by 0.31 and 0.39 mmol/L, respectively, were observed in the Glibenclamide arm. However, the CI of between-group difference in triglyceride was −0.24, 0.72 mmol/L. The TCM diabetes symptom score was significantly lower in the Xiaoke Pill arm with between-group difference of −1.65 (95% CI: −2.66, −0.64).

Adverse Events

No serious adverse event was reported during the study. The proportions of adverse events, which were reported in only four categories, did not differ significantly (Table S2). For those with dyslipidemia, the average levels of cholesterol and triglyceride did not differ significantly between the treatments.

Discussion

Our study showed that Xiaoke Pill is associated with reduced risk of hypoglycemia and has similar glucose-lowing efficacy as compared with glibenclamide. At the same level of glibenclamide dose and glycemic control, the Xiaoke Pill had clearly demonstrated a reduced incidence and rate of hypoglycemia as compared with glibenclamide, suggesting that the TCM in the Xiaoke Pill had protective effects against hypoglycemia induced by glibenclamide. The herb components in Xiaoke pill include Radix Puerariae, Radix Rehmanniae, Radix Astragali, Radix Trichosanthis, Stylus Zeae Maydis, Fructus Schisandrae Sphenantherae, an d Rhizoma Dioscoreae. A recent study showed Radix astragali, which is one of the TCM components of Xiaoke Pill, could amplify the glucose counter-regulatory response to insulin-induced hypoglycemia in rats [20]. Radix astragali might exert its action directly, or indirectly, in two brain regions, the paraventricular hypothalamus (PVN) and nucleus tractus solitaries (NTS), known to be involved in glucose-sensing during hypoglycemia [20]. One Chinese study found Radix Puerariae could protect neuron from hypoglycemic and hypoxia damage in vitro cell experiment [21]. However, most of the studies focus on the anti-oxidative effect of the traditional Chinese herbs. More studies are needed to interpret the mechanism of TCM’s anti-hypoglycemia effect.

Between 4 and 24 weeks of the study, 97 (52.7%) and 95 (51.6%) patients in the treatment naïve group reduced HbA1c below 6.5% in the Xiaoke Pill and Glibenclamide arms, respectively. During same period, 129 (70.1%) and 125 (67.9%) patients reduced FPG below 7 mmol/L. At 48 week, the absolute changes in FPG levels were also similar in the two treatment arms in both study groups (Fig. S1). Our study design allowed comparing the TCM in the Xiaoke Pill to its placebo on top of equal amount of glibenclamide. Given the label limitation on maximum dosage of Xiaoke Pill, the low dose usage of glibenclamide in this trial gave more opportunity of detecting the glucose-lowing effect of TCM.

Five prior studies published in medical journals in China [22]–[26] showed significant improvement in diabetes symptoms in favor of Xiaoke Pill. These 4–8 weeks open-level studies were mostly single centre studies, and only one study assessed the hypoglycemic events. However, the validity of the design of these studies is questionable, and makes it hard to draw any robust conclusion with regard to safety and efficacy of Xiaoke Pill [27].

Xiaoke Pill was associated with greater improvement in symptoms of diabetes in a pre-specified subgroup analysis. However, caution should be taken in interpreting this result, as improvement in symptoms might also be associated with the reduction of hypoglycemia risk observed in Xiaoke Pill treatment arm. Symptoms associated with hypoglycemia such as fatigue, hunger, and palpitation were included in the score system. Further study is needed to validate this finding with the consideration that this finding might be specific to clinical studies involving glucose lowing agents that could cause hypoglycemia.

No differences were observed in changes in insulin resistance, β-cell function, HDL, triglyceride, blood pressure, hsCRP and adiponectin (data not presented) between Xiaoke Pill and Glibenclamide treatment arms. Such results suggest that TCM in Xiaoke pill had no additional impact on the pathophysiological changes associated with type 2 diabetes.

TCM is used widely in treating type 2 diabetes not only in China, but also in the other parts of the world. But the role of TCM and other herbal medicines in the management of type 2 diabetes is still not established [28]. The absence of scientific understanding has caused skepticism and criticism about TCM, often because of the low methodological quality of trials [8], [9], [11], [29], [30]. Furthermore, most of these trials were published in Chinese and were not included in systematic reviews. Selective publication of positive trials is another problem. Over 80% [28] of people in developing countries depend on herbal medicine for basic health care. Thus the evidence for safety and efficacy of TCM use for treatment of diabetes, provided by this study, is a contribution towards reducing entrenched inequity in access to effective care for poor people.

Supporting Information

Table S1.

Score of TCM symptoms of diabetes.

doi:10.1371/journal.pone.0056703.s001

(DOC)

Table S2.

Adverse Events.

doi:10.1371/journal.pone.0056703.s002

(DOC)

Figure S1.

Mean (95% CI) percentage change at 48 weeks from baseline in Glycated Hemoglobin, Fasting Plasma Glucose and Symptom Score.

doi:10.1371/journal.pone.0056703.s003

(DOC)

Checklist S1.

CONSORT checklist.

doi:10.1371/journal.pone.0056703.s004

(DOC)

Protocol S1.

Trial protocol.

doi:10.1371/journal.pone.0056703.s005

(DOC)

Appendix S1.

List of Investigators.

doi:10.1371/journal.pone.0056703.s006

(DOC)

Acknowledgments

We thank all the patients for agreeing to participate in this study. We are grateful to the nurses as well as technicians in the laboratory for their practical work during the study.

Author Contributions

Critically revised the menuscript for important intellectual content: LJ HW HT HZ LZ Qifu Li YW HL ML HY YG YL Quanmin Li XG GY Z. Zhang Z. Zhou GN YC SP Performed the experiments: The Evidence-Based Medical Research of Xiaoke Pill Study Group. Conceived and designed the experiments: LJ XT HT XG ML Qifu Li YL. Performed the experiments: The Evidence-Based Medical Research of Xiaoke Pill Study Investigators. Analyzed the data: LJ YL SP. Contributed reagents/materials/analysis tools: HW SP. Wrote the paper: LJ SP. Critically revised the manuscript for important intellectual content: LJ HW HT HZ LZ Qifu Li YW HL ML HY YG YL Quanmin Li XG GY Z. Zhang Z. Zhou GN YC SP.

References

1. 1. Cheng JT (2000) Review: drug therapy in Chinese traditional medicine. The Journal of Clinical Pharmacology 40: 445–450. doi: 10.1177/00912700022009198. Find this article online
2. 2. Zhang H, Tan C, Wang H, Xue S, Wang M (2010) Study on the history of Traditional Chinese Medicine to treat diabetes. Eur J of Integr Med 2: 41–46. doi: 10.1016/j.eujim.2010.02.004. Find this article online
3. 3. Ni MS (1995) The Yellow Emperor’s Classic of Medicine: A New Translation of the NeijingSuwen with Commentary. Boston, MA: Shambhala Publications. 316 p.
4. 4. Cang Chung-Ching HH (1983) Chin Kuei You Lueh. Long Beach: Oriental Healing Arts Institute: 240 p.
5. 5. Hsu HY (1978) Chinese herb therapy for diabetes mellitus. Bull of the Oriental Healing Arts Inst 3: 12–17. Find this article online
6. 6. Sena M, Chuang G, Tam W, Tam G, Tam C (2009) Survey of biological active molecules in the Chinese traditional herbal formula LiuWeiDiHuangWan for the treatment of Type II Diabetes. FASEB J 23: 900–905. Find this article online
7. 7. Zhang Y, Ma Y, Zhou W, Chen J, Wei C (2004) Effect of LiuweiDihuang decoction on the function of hypothalamus-pituitary-ovary axis in senescence-accelerated mouse. Int Congress Ser 1260: 421–426. doi: 10.1016/S0531-5131(03)01684-4. Find this article online
8. 8. Li WL, Zheng HC, Bukuru J, Kimpe ND (2004) Natural medicines used in the traditional Chinese medical system fortherapy of diabetes mellitus. J Ethnopharmacol 92: 1–21. doi: 10.1016/j.jep.2003.12.031. Find this article online
9. 9. Liu JP, Zhang M, Wang WY, Grimsgaard S (2004) Chinese herbal medicines for type 2 diabetes mellitus. Cochrane Database Syst Rev 3: CD003642. Find this article online
10. 10. Xie WD, Zhao Y, Zhang Y (2011) Traditional Chinese Medicines in Treatment of Patients with Type 2 Diabetes Mellitus. Evidence-Based Complementary and Alternative Medicine 726723. doi: 10.1155/2011/726723. Find this article online
11. 11. Yeh GY, Eisenberg DM, Kaptchuk TJ, Phillips RS (2003) Systematic review of herbs and dietary supplements for glycemic control in diabetes. Diabetes Care 26: 1277–1294. doi: 10.2337/diacare.26.4.1277. Find this article online
12. 12. Ye TS (2006) Record of medical practice. Beijing: People’s Medical Publishing House. 553 p.
13. 13. Zhu DX, Yang SZ (1993) The Heart and Essence of Dan-xi’s Methods of Treatment. Boulder, CO: Blue Poppy Press. 450 p.
14. 14. Pharmacopoeia Commission (2010) Pharmacopoeia of the People’s Republic of China. Beijing: China Medical Science and Technology Press. 1248 p.
15. 15. Li M, Fisette A, Zhao XY, Deng JY, Mi J, et al. (2009) Serum resistin correlates with central obesity but weakly with insulin resistance in Chinese children and adolescents. Int J Obes 33: 424–439. doi: 10.1038/ijo.2009.44. Find this article online
16. 16. Zheng X (2010) Principal Guideline For the Development of New Traditional Chinese Medicine. Beijing: China Medical Science Press. 727 p.
17. 17. Home PD, Jones NP, Pocock SJ, Beck-Nielsen H, Gomis R, et al. (2007) Rosiglitazone RECORD study: glucose control outcomes at 18 months. Diabet Med 24: 626–634. doi: 10.1111/j.1464-5491.2007.02160.x. Find this article online
18. 18. Kenward MG, Carpenter J (2007) Multiple imputation: current perspectives. Stat Methods Med Res 16: 199–218. doi: 10.1177/0962280206075304. Find this article online
19. 19. Demidenko E (2004) Mixed models: theory and applications. Hoboken, NJ: Wiley. 736 p.
20. 20. Sang Z, Zhou L, Fan X, McCrimmon RJ (2010) Radix astragali (huangqi) as a treatment for defective hypoglycemia counterregulation in diabetes. Am J Chin Med 38: 1027–1038. doi: 10.1142/S0192415X10008445. Find this article online
21. 21. Xu XH, Zheng XX (2008) Effects of Puerarin on the Levels of Calcium and Nitric Oxide in Cultured H ippocampal Neurons during Oxygen-G lucose Deprivation. Chin Pharm J 43: 1308–1312. Find this article online
22. 22. Zhou R, Guo JJ, Yin CM, Li TK (2003) Clinical observations of Xiaoke Wan in treatment of type 2 diabetic patients(Qi and Yin deficiency zheng). Zhong guoYao Wu Yu Lin Chuang 3: 131–132. Find this article online
23. 23. Zhang HZ (1999) Clinical observation into Xiaoke Wan in the treatment of 86 cases of type 2 diabetic patients. Zhong Yi Yao Yan Jiu 15: 19–21. Find this article online
24. 24. Zhao YC, Hou M (1998) Xiaoke Wan in treatment of 200 cases of type 2 diabetic patients. Changchun Zhong Yi Xue Yuan Xue Bao 14: 15. Find this article online
25. 25. Chen G, Ni YD, Lai XM, Liang HQ (2003) Clinical study on Xiaoke Wan in treating type 2 diabetes mellitus with Qiand Yin Defiency. Zhong Yao Xin Yao Yu Lin Chuang Yao Li 14: 84–86. Find this article online
26. 26. Wu JL (2005) Observations into the effects of Xiaoke Wan in treatment of diabetes. Shi Yong Zhong Xi Yi Jie He Lin Chuang 5: 18–19. Find this article online
27. 27. Wang G, Mao B, Xiong ZY, Fan T, Chen XD, et al. (2007) The Quality of Reporting of Randomized Controlled Trials of Traditional Chinese Medicine: A Survey of 13 Randomly Selected Journals from Mainland China. Clin ther 29: 1456–1467. doi: 10.1016/j.clinthera.2007.07.023. Find this article online
28. 28. European Medicines Agency (2005) Public statement on the risk associated with the use of herbal products containing Aristolochia species. Available: http://www.emea.europa.eu/pdfs/human/hmp​c/13838105en.pdf. Accessed 2008 Jul 10.
29. 29. Tang JL, Zhan SY, Ernst E (1999) Review of randomised controlled trials of traditional Chinese medicine. BMJ 319: 160–161. doi: 10.1136/bmj.319.7203.160. Find this article online
30. 30. Wang E, Wylie-Rosett J (2008) Review of selected Chinese herbal medicines in the treatment of type 2 diabetes. Diabetes Educ 34: 645–654. doi: 10.1177/0145721708320559. Find this article online

Citation: de Bock M, Derraik JGB, Brennan CM, Biggs JB, Morgan PE, et al. (2013) Olive (Olea europaea L.) Leaf Polyphenols Improve Insulin Sensitivity in Middle-Aged Overweight Men: A Randomized, Placebo-Controlled, Crossover Trial. PLoS ONE 8(3): e57622. doi:10.1371/journal.pone.0057622

Editor: Pratibha V. Nerurkar, College of Tropical Agriculture and Human Resources, University of Hawaii, United States of America

Received: October 14, 2012; Accepted: January 24, 2013; Published: March 13, 2013

Copyright: © 2013 de Bock et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: This study was supported by a TECHNZ grant (University of Auckland – UniS 30475.001) through the New Zealand Ministry of Science and Innovation (MSI). TECHNZ grants are funded 50% by the MSI, and 50% by a commercial partner following an extensive independent science review process. In this project, the commercial partner was the olive leaf extract manufacturer (Comvita). MdB was funded by the Joan Mary Reynolds Trust. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: TECHNZ grants are funded 50% by the MSI, and 50% by a commercial partner following an extensive independent science review process. In this project, the commercial partner was the olive leaf extract manufacturer (Comvita), who supplied the olive leaf extract (OLE) and placebo for this study. The authors have no further patents, products in development or marketed products to declare. This does not alter the authors’ adherence to all the PLOS ONE policies on sharing data and materials, as detailed online in the guide for authors.

Introduction

It is estimated that 20–50% of the European population use complementary or alternative therapy to treat disease or to help prevent its onset [1]. In Britain, approximately 40% of general practitioners provide complementary therapies for their patients [2]. With respect to type 2 diabetes, one third of patients actively use alternative medicine to manage their disease, despite the paucity of scientific evidence to support its use [3]. The leaves of the olive plant (Olea europaea L.) have been used for centuries in folk medicine to treat diabetes [4]. Recently, the medicinal properties of olive products have focussed on its polyphenols (particularly oleuropein and hydroxytyrosol), which according to animal and in vitro studies have antioxidant, hypoglycaemic, antihypertensive, antimicrobial, and anti-atherosclerotic properties [5]. Polyphenols are found in most edible plants, and are reportedly responsible for the health benefits associated with the consumption of chocolate, coffee, green tea, and red wine [6].

The nutraceutical market exploring the potential health benefits of olive products is expanding. The concentration of olive plant polyphenols is far greater in the leaves than in the fruit or fruit oil, and the leaves that were once discarded as by-products of tree pruning are now considered a valuable commodity. However, while the cardiovascular health benefits of a Mediterranean diet rich in olive oil is well established [7], clinical studies examining the effects of olive polyphenols supplementation on cardiovascular disease risk are scarce, flawed, or contradictory. Thus, although the European Food Safety Authority has endorsed the health claim that “the consumption of olive oil polyphenols contributes to the protection of blood lipids to oxidative damage”, it has rejected several other health claims [8].

There are very limited data examining the effects of olive polyphenols on glucose homeostasis in humans. Thus, we conducted a randomized, double-blinded, placebo-controlled, crossover trial to assess whether supplementation with olive leaf polyphenols would affect modifiable cardiovascular risk factors in overweight males, who by virtue of their body mass are likely to be insulin resistant. In addition, plasma markers involved in the development of cardiovascular disease were investigated. Potential mechanisms underpinning the clinical outcomes were also examined.

Methods

Ethics Statement

Ethics approval for this study was provided by the Northern Y Regional Ethics Committee (New Zealand Ministry of Health), and written informed consent was obtained from all participants. This study was registered with the Australian New Zealand Clinical Trials Registry (#336317). The protocol for this trial and supporting CONSORT checklist are available as supporting information (see Checklist S1 and Protocol S1).

Subjects

Overweight males (BMI 25–30 kg/m²) aged 35–55 years were eligible to participate. Volunteers were recruited in February 2011 via advertisements in local newspapers that circulate freely in the central Auckland metropolitan area. Exclusion criteria were: illicit drug use (including tobacco), diabetes, or being on medications likely to affect insulin sensitivity. Subjects taking antihypertensive or lipid-lowering medications were recruited, but were required to have been on a stable dose for at least 6 months prior to start of the study. These subjects were also encouraged not to change dose throughout the trial, and doses were checked at each assessment. Further, all participants were asked not to make any substantial alterations to their lifestyle for the duration of the trial. Specifically, participants were instructed not to make changes to their diet and physical activity levels.

Randomization and Masking

Randomized allocation was done using computer random number generation. The code was kept by an independent third party, and was not released until after statistical analysis. Both researchers and subjects were ‘blinded’ to the contents of capsules being taken. To maintain integrity of the trial evaluation, statistical analyses were carried out on encoded data, such that the analyst (JGBD) was also ‘blinded’ to treatment.

Study Design

This was a 30-week randomized, double-blinded, placebo-controlled, crossover trial. Participants were randomized to receive capsules with olive leaf extract (OLE) or placebo (Comvita, Auckland, New Zealand) for 12 weeks, which is the minimum study period that can reliably detect a sustained effect of dietary intervention [9]. Participants then switched over to the other treatment after a 6-week washout period. The polyphenol content of the OLE was independently verified (Table 1). Participants were instructed to take four capsules as a single dose, once a day, with a glass of water, equating to a daily dose of 51.1 mg oleuropein and 9.7 mg hydroxytyrosol for participants on active treatment. OLE was suspended in safflower oil, while placebo capsules contained safflower oil only. Importantly, placebo and active capsules were both odourless and identical in appearance (opaque green soft capsules), size, and grade.

We have shown that following ingestion of an identical dose of OLE, olive polyphenol metabolites in plasma peak after 80 minutes and are cleared by 240 minutes (de Bock et al, unpublished data). Nonetheless, we chose a generous 6-week washout period, after which participants crossed to the opposite intervention (Figure 1). All clinical assessments were carried out between 06:30 and 08:30 at the Maurice & Agnes Paykel Clinical Research Unit (Liggins Institute, University of Auckland), after an overnight fast and no strenuous activity over the previous 24 hours. Participants were instructed not to take their assigned capsules on the morning of investigation. Subjects were assessed at the start of the study, and at the end of each intervention phase. Blood samples were collected and placed on ice; following separation, plasma and serum were stored at −20 and −80°C, respectively, for later analysis.

Primary Outcome

The primary outcome was insulin sensitivity, assessed via a 75 g oral glucose tolerance test. Insulin sensitivity (ISI) was assessed using the Matsuda method, with glucose and insulin samples collected at 0, 30, 60, 90, and 120 minutes [10]. The Matsuda method has a strong correlation with the hyperinsulinemic euglycaemic clamp (r = 0.77) [11], and excellent reproducibility during multiple measures [12].

Secondary Outcomes

Other parameters of glucose homeostasis assessed included pancreatic β-cell function, also calculated from the oral glucose tolerance test: the product of insulin sensitivity (derived by the Matsuda method) and the change in glucose and insulin over the first 30 minutes (oral disposition index) [13]. Glucose and insulin profiles after the glucose challenge were calculated and expressed as the area under the curve (AUC).

To identify potential underpinning mechanisms, fasting blood samples were used to assess cytokines known to influence glucose metabolism: insulin-like growth factor I (IGF-I), IGF-II, IGF binding protein 1 (IGFBP-1), IGFBP-2, IGFBP-3, ultra-sensitive C-reactive protein (CRP), tumor necrosis factor-alpha (TNF-α), interleukin-6, and interleukin-8.

Fasting blood samples were also used to assess lipid profile, namely triglycerides, total cholesterol, high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C). Liver function tests were also performed at each assessment, with measurements of aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase (ALP), and gamma-glutamyl transferase (GGT).

Auxological assessment included height measurement using a Harpenden stadiometer. Weight and body composition were assessed using whole-body dual-energy X-ray absorptiometry (DEXA, Lunar Prodigy 2000, General Electric, Madison, USA). Body composition data of interest were total percentage body fat and the ratio of android fat to gynoid fat. Note that android and gynoid fat values were determined by the manufacturer’s software, based on an automated sectioning of specific areas of the body [14].

24-hour ambulatory blood pressure monitoring was carried out prior to each clinical assessment. Participants were fitted with a Spacelabs 90207 or 90217 (Spacelabs Medical Inc., Redmond, USA), with each subject being assigned the same device model for all assessments. Measurements were performed every 20 minutes between 07:00 and 22:00, and every 30 minutes from 22:00 to 07:00. Only profiles with a total of at least 40 readings over a 24-hour period were analysed [15].

Carotid intima-media thickness (cIMT) was also measured to assess possible treatment effects, as it is a validated and reproducible measure that is predictive of cardiovascular and cerebrovascular risks [16]. cIMT was measured using an M-Turbo ultrasound system (Sonosite, Bothel, USA) by a trained investigator [MdB], with images attained using a standard protocol [17]. The far wall of the right common carotid artery was used for all three assessment points. Digitally stored images were analysed by a single reader [MdB] using computer software automated callipers (SonoCalctm v.4.1, Sonosite). A maximal cIMT measurement approximately 10 mm proximal to the carotid bulb was used for comparative analysis. To assess reproducibility, triplicate measures were taken of seven healthy volunteers over a 7-day interval, and resulted in an intra-observer CV of 3.7% (unpublished data).

Lifestyle factors were recorded with an itemised food diary and a physical activity recall. Three-day dietary records were collected at baseline and at clinical assessment following each 12-week intervention. Each dietary report encompassed an itemized nutritional intake recorded during two week days (Monday to Friday) and one weekend day. Nutritional intake was recorded using standard household measures, as well as the information from food labels where appropriate. Participants were instructed by a trained investigator [MdB], who also reviewed all food records with each participant to address unclear descriptions, errors, omissions, or doubtful entries. Records were subsequently entered into Foodworks software (v6.0, Xyris Software, Brisbane, Australia) by the trained investigator [MdB]. Physical activity levels were assessed using the International Physical Activity Questionnaire (IPAQ) [18], covering four domains of physical activity: work-related, transportation, housework/gardening, and leisure time.

In addition, subjective measures of wellbeing were assessed by the Medical Outcomes Study Short Form (SF-36: New Zealand/Australia adaptation). The SF-36 is a validated tool that measures perception of health on eight multi-item dimensions covering functional status, wellbeing, and overall evaluation of health [19].

Assays

Insulin concentrations were measured using an Abbott AxSYM system (Abbott Laboratories, Abbott Park, USA) by microparticle enzyme immunoassay with an inter-assay coefficient of variation (CV) of 5.4%. Glucose concentrations were measured on a Hitachi 902 autoanalyser (Hitachi High Technologies Corporation, Tokyo, Japan) by enzymatic colorimetric assay (Roche, Mannheim, Germany) with a CV of 2.1%. Commercially available ELISAs were used to measure plasma IGF-I, IGF-II, IGFBP-1, IGFBP-2, and IGFBP-3 (Meddiagnost, Reutlingen, Germany) with CV of 3.5, 0.9, 3.6, 8.8, and 8.5%, respectively). Commercially available ELISA kits were used to evaluate TNF-α, interleukin-6, and interleukin-8 (Invitrogen, Carlsbad, USA) with CV of 9.3%, 7.4, and 3.4%, respectively, and oxidised LDL-C (Mercodia, Uppsala, Sweden) with a CV of 5.7%. Commercially available ELISA kits were used to evaluate ultra-sensitive CRP (USCN Life Science, Wuhan, China) with a CV of 10%. Triglycerides, total cholesterol, HDL-C, LDL-C, AST, ALT, ALP, and GGT concentrations were measured on a Hitachi 902 autoanalyser (Hitachi High Technologies Corporation) by enzymatic colorimetric assay (Roche) with a CV lower than 2.5%.

Sample Size

The power calculation was based upon a known mean adult Matsuda index of 15.6 and standard deviation of 8.7 [20]. A sample of 46 participants in total would have at least 80% power at 5% level of significance (two-sided) to detect a 25% difference in Matsuda index with and without OLE. This was based on the assumption of a correlation of 0.5 between measurements on the same subject, and a 10% drop out rate during the study.

Statistical Analysis

Treatment evaluations (i.e. OLE vs placebo) were based on the principle of intention-to-treat (ITT). All statistical tests were two-sided and a 5% significance level maintained throughout the analyses. Statistical analyses were performed in SAS v.9.2 (SAS Institute, Cary, USA). Linear mixed models were used to assess the main treatment effect accounting for randomization sequences and time periods. Importantly, regression models also adjusted for the baseline value of the outcome response to gain statistical efficiency and power (i.e. baseline data were included in the model as covariates). Other confounders that were considered in the analysis included: on-going use of medication (for cholesterol or hypertension), IPAQ scores, age, and total body fat percentage (from DEXA scans). When necessary, response variables were log-transformed to approximate normality. Baseline descriptive data are presented as mean ± standard deviation (SD). The results from linear mixed models are expressed as model-adjusted means and 95% confidence intervals.

Results

Forty-six eligible participants were randomized into the trial (Figure 1). Four participants were on cholesterol lowering medication, three were on antihypertensives, and two were on both. Compliance with the study protocol was very high (>96% as measured by counting capsules in regularly returned containers), and no participants missed more than 3 doses.

One participant dropped out of the study during stage 1 (due to injury), and two withdrew after crossover (one was lost to follow up, another due to developing acne) (Figure 1). All three subjects that withdrew were taking placebo at the time. Thus, data from 45 participants were included into intention-to-treat analyses.

All participants were overweight, most were New Zealand Europeans (89%), and aged 46.5 years (range 34.5–55.6) (Table 2). Their metabolic profiles at baseline are itemized on Table 2. Daily energy intake among participants prior to study is show in Table 2, and was mostly unchanged throughout the trial. There was however, an increased energy intake from sugars during OLE supplementation (17.3 vs 14.7%; p = 0.036). There were no changes in physical activity levels over the study period as assessed by the IPAQ (Placebo = 4651 vs OLE = 4649 METs; p = 0.85).

Insulin Sensitivity and Other Parameters on Glucose Homeostasis

The assessment of treatment effect (i.e. OLE vs placebo) showed that OLE supplementation was associated with a 15% improvement in insulin sensitivity (5.46 vs 4.73; p = 0.024) (Table 3). Supportive findings included a 28% improvement in pancreatic β-cell function (5.45 vs 4.26; p = 0.013) (Table 3). Further, OLE supplementation also led to a reduction in the area under the curve for both glucose (6%; p = 0.008) and insulin (14%; p = 0.041) (Figure 2). These findings were consistent with observed reductions following OLE treatment in glucose concentrations at 30 (6%; p = 0.008) and 60 (10%; p = 0.005) minutes, as well as a 23% reduction in insulin concentrations at 60 minutes (p = 0.004) (Figure 2).

Subjects on OLE also experienced a 32% increase in interleukin-6 (p = 0.014), but there were no observed changes in interleukin-8, TNF-α, or ultra-sensitive CRP (Table 3). While there were no differences in IGF-I, IGF-II, or IGFBP-3 plasma concentrations, OLE supplementation was associated with an increase of 20% in IGFBP-1 (p = 0.024) and 13% in IGFBP-2 (p = 0.015) concentrations (Table 3). There were no significant changes in lipid profile (including oxidised LDL-C), ambulatory blood pressure, body composition (Table 3), or carotid intima-media thickness (OLE 0.820 (0.782–0.859) vs Placebo 0.832 (0.795–0.871) mm; p = 0.40). There were also no significant changes in subjective assessment of wellbeing (data not shown).

Adverse Outcomes

The only adverse event reported was a flare up of acne. The participant withdrew from the study and un-blinding showed that he was receiving placebo. Liver function tests showed no differences in AST, ALP, ALT, or GGT among participants in OLE vs placebo (data not shown).

Subgroup Analyses

Data were also analysed on a subgroup of 36 participants, excluding 9 subjects who were on lipid-lowering and/or anti-hypertensive medications (Table 4). The results changed very little, but importantly, there was evidence of an even greater effect of OLE on insulin sensitivity (20%) compared to placebo (5.94 vs 4.96; p = 0.009) (Table 4).

Discussion

We have shown that supplementation with olive leaf polyphenols for 12 weeks improves two aspects of glucose regulation (both insulin action and secretion) in a cohort of overweight middle-aged men. This novel finding was independent of lifestyle factors (such as dietary intakes and physical activity levels), BMI, or fat distribution. Importantly, the 15–20% improvement in insulin sensitivity observed with OLE supplementation is comparable to those seen with medications commonly used to treat diabetes. For example, metformin (250 mg TDS) improved insulin sensitivity by 17% in a group of sedentary overweight non-diabetics [21]. However, as Ou et al.’s cohort reported lower levels of physical activity than our participants [21], the use of metformin in our study group would likely have led to a comparatively smaller improvement in insulin sensitivity. Thus, we speculate that the observed improvement in insulin sensitivity with OLE is greater than would have otherwise been observed if our subjects have been treated with metformin instead. Another study demonstrated a 28% improvement in insulin sensitivity after treatment with 30 mg pioglitazone for 26 weeks [22]; but as their participants had type 2 diabetes, they are also likely to have shown an exaggerated response compared to our study group.

In addition, OLE also improved insulin secretion to further aid glucose regulation, which does not occur with the use of metformin. Type 2 diabetes generally involves defects in both insulin sensitivity and pancreatic β-cell secretory capacity [23], [24]. OLE supplementation was associated with a reduction in the glucose and insulin excursion after oral glucose challenge, suggesting an improvement in both pancreatic β-cell function and insulin sensitivity. The observed 28% improvement in disposition index is consistent with this observation. Comparatively, studies in diabetic adults (who are likely to have an exaggerated response to therapy) have shown that mainstream medications affecting only β-cell secretion capacity have achieved improvements of 55% (dipeptidyl peptidase-4 antagonists) [25] and 100% (glucagon-like peptide-1 agonists) [26]. Hence, compared to these drugs that only improve insulin secretion, OLE improves both insulin sensitivity and pancreatic β-cell secretory capacity. Remarkably, the observed effects of OLE supplementation in our study population is comparable to common diabetic therapeutics (particularly metformin), and our results could have clinical significance for patients with type 2 diabetes.

Only one randomized placebo-controlled trial has previously investigated the effects of OLE on glucose metabolism in subjects with type 2 diabetes, finding an improvement in glycated haemoglobin (HbA1c) after 14 weeks of supplementation [27]. However, that study did not measure or discuss possible variations in diet or levels of physical activity among participants [27], so that the independent effect of OLE cannot be determined. Hence, our study is the first to show the independent effects of OLE on glucose homeostasis in humans, corroborating previous findings in vitro and in animal models [5].

We also found elevated interleukin-6 levels (a pro-inflammatory cytokine) with OLE supplementation. Interleukin-6 functions differently depending on its concentration and the tissue it acts upon. Acute increases improve the insulin-regulated glucose metabolism in the muscle [28], while chronically mildly elevated levels are associated with a pro-inflammatory insulin resistant state in the liver. Thus, OLE supplementation may improve insulin sensitivity and glucose uptake via interleukin-6, and possible mechanisms for this effect have been proposed [29], [30]. Further, we also observed that OLE supplementation led to increased IGFBP-1 and IGFBP-2 plasma concentrations. Increased IGFBP-2 concentrations are protective against the development of obesity and improve insulin sensitivity [31], while higher IGFBP-1 concentrations are associated with lower insulin levels [32].

In regards to other measured cardiovascular outcomes, OLE supplementation did not improve 24-hour ambulatory blood pressure, lipid profile, or cIMT. Previous studies have shown improvements in blood pressure with OLE supplementation [33], [34], but they did not involve 24-hour monitoring. Similarly, our findings on lipid profile also contrast with those of previous studies [33], [34], [35]. However, Perrinjaquet-Moccetti et al. did not examine dietary factors [33], Susalit et al. had a low cholesterol dietary component to the trial [34], and Fonolla et al. studied hypercholesterolemic subjects [35]. In addition, although we did not observe improvements in cIMT, this null result may be a result of our relatively short intervention. Nonetheless, consistent with our findings, the European Food Safety Authority recently concluded that there was insufficient evidence to substantiate health claims of improvements on blood pressure, lipid profile, or anti-inflammatory effects [8].

The strengths of this study lie with it being a randomized, double-blinded, placebo-controlled, crossover trial, using well-validated scientific methods (i.e. ambulatory blood pressure, Matsuda method, and cIMT). Although insulin sensitivity was not measured using the gold-standard euglycemic hyperinsulinemic clamp, it was assessed using the Matsuda method that is one of the best performing proxy methods [11]. In addition, we adopted a comprehensive approach to modifiable cardiovascular risk factors, including attention to dietary intakes and physical activity levels. The OLE supplement was well-tolerated, and compliance with the study protocol was excellent. Potential weaknesses include the relatively short intervention, which may have obscured pathophysiological changes that require longer periods of time to develop.

Overall, this is the largest and most comprehensive study to date examining the effect of supplemented olive leaf polyphenols alone on modifiable cardiovascular risk factors. We showed improvements in insulin sensitivity and pancreatic β-cell secretion capacity, in a cohort of overweight middle-aged men. Future research should evaluate the potential effects of olive leaf polyphenols on insulin sensitivity and glycaemic control (HbA1c) in patients with type 2 diabetes, and compare any such effects to conventional therapy (e.g. metformin).

Supporting Information

Protocol S1.

Trial Protocol.

doi:10.1371/journal.pone.0057622.s001

(DOCX)

Checklist S1.

CONSORT Checklist.

doi:10.1371/journal.pone.0057622.s002

(DOC)

Acknowledgments

Thanks also to Dr Yannan Jiang (Department of Statistics, University of Auckland) for very valuable input.

Author Contributions

Conceived and designed the experiments: MdB WSC SCH PLH. Performed the experiments: MdB CMB JBB PEM. Analyzed the data: JGBD. Wrote the paper: MdB JGBD WSC.

References

1. 1. Fisher P, Ward A (1994) Medicine in Europe: complementary medicine in Europe. BMJ 309: 107–111. doi: 10.1136/bmj.309.6947.107. Find this article online
2. 2. Schmidt K, Jacobs P, Barton A (2002) Cross-cultural differences in GPs’ attitudes towards complementary and alternative medicine: a survey comparing regions of the UK and Germany. Complement Ther Med 10: 141–147. doi: 10.1016/S0965229902000560. Find this article online
3. 3. Yeh GY, Eisenberg DM, Kaptchuk TJ, Phillips RS (2003) Systematic review of herbs and dietary supplements for glycemic control in diabetes. Diabetes Care 26: 1277–1294. doi: 10.2337/diacare.26.4.1277. Find this article online
4. 4. Komaki E, Yamaguchi S, Maru I, Kinoshita M, Kakehi K, et al. (2003) Identification of anti-α-amylase components from olive leaf extracts. Food Sci Technol Res 9: 35–39. doi: 10.3136/fstr.9.35. Find this article online
5. 5. El SN, Karakaya S (2009) Olive tree (Olea europaea) leaves: potential beneficial effects on human health. Nutr Rev 67: 632–638. doi: 10.1111/j.1753-4887.2009.00248.x. Find this article online
6. 6. de Bock M, Derraik JGB, Cutfield W (2012) Polyphenols and glucose homeostasis in humans. Journal of the Academy of Nutrition and Dietetics 112: 808–815. doi: 10.1016/j.jand.2012.01.018. Find this article online
7. 7. Keys A (1995) Mediterranean diet and public health: personal reflections. Am J Clin Nutr 61: 1321S–1323S. Find this article online
8. 8. Agostoni CV (2011) Scientific Opinion on the substantiation of health claims related to polyphenols in olive and protection of LDL particles from oxidative damage (ID 1333, 1638, 1639, 1696, 2865), maintenance of normal blood HDL-cholesterol concentrations (ID 1639), maintenance of normal blood pressure (ID 3781), anti-inflammatory properties (ID 1882), contributes to the upper respiratory tract health (ID 3468), can help to maintain a normal function of gastrointestinal tract (3779), and contributes to body defences against external agents (ID 3467) pursuant to Article 13 (1) of Regulation (EC) No 1924/2006. EFSA journal 9: 2033.2031–2033.2025. Find this article online
9. 9. EFSA Panel on Dietetic Products Nutrition (2012) Allergies (2012) Guidance on the scientific requirements for health claims related to appetite ratings, weight management, and blood glucose concentrations. EFSA Journal 10: 2604. Find this article online
10. 10. Matsuda M, DeFronzo RA (1999) Insulin sensitivity indices obtained from oral glucose tolerance testing: comparison with the euglycemic insulin clamp. Diabetes Care 22: 1462–1470. doi: 10.2337/diacare.22.9.1462. Find this article online
11. 11. Lorenzo C, Haffner SM, Stančáková A, Laakso M (2010) Relation of direct and surrogate measures of insulin resistance to cardiovascular risk factors in nondiabetic finnish offspring of type 2 diabetic individuals. J Clin Endocrinol Metab 95: 5082–5090. doi: 10.1210/jc.2010-1144. Find this article online
12. 12. Maki KC, Rains TM, Dicklin MR, Bell M (2010) Repeatability of indices of insulin sensitivity and secretion from standard liquid meal tests in subjects with type 2 diabetes mellitus or normal or impaired fasting glucose. Diabetes Technol Ther 12: 895–900. doi: 10.1089/dia.2010.0083. Find this article online
13. 13. Kahn S, Prigeon R, McCulloch D, Boyko E, Bergman R, et al. (1993) Quantification of the relationship between insulin sensitivity and beta-cell function in human subjects. Evidence for a hyperbolic function. Diabetes 42: 1663–1672. doi: 10.2337/diabetes.42.11.1663. Find this article online
14. 14. Novotny R, Going S, Teegarden D, Van Loan M, McCabe G, et al. (2007) Hispanic and Asian pubertal girls have higher android/gynoid fat ratio than whites. Obesity 15: 1565–1570. doi: 10.1038/oby.2007.185. Find this article online
15. 15. Wühl E, Witte K, Soergel M, Mehls O, Schaefer F (2002) Distribution of 24-h ambulatory blood pressure in children: normalized reference values and role of body dimensions. J Hypertens 20: 1995. doi: 10.1097/00004872-200210000-00019. Find this article online
16. 16. Tardif JC, Lesage F, Harel F, Romeo P, Pressacco J (2011) Imaging biomarkers in atherosclerosis trials. Circ Cardiovasc Imaging 4: 319–333. doi: 10.1161/CIRCIMAGING.110.962001. Find this article online
17. 17. Raitakari OT, Juonala M, Kähönen M, Taittonen L, Laitinen T, et al. (2003) Cardiovascular risk factors in childhood and carotid artery intima-media thickness in adulthood. JAMA 290: 2277–2283. doi: 10.1016/j.accreview.2004.02.081. Find this article online
18. 18. Hagstromer M, Oja P, Sjostrom M (2006) The International Physical Activity Questionnaire (IPAQ): a study of concurrent and construct validity. Public Health Nutr 9: 755–762. doi: 10.1079/PHN2005898. Find this article online
19. 19. Brazier J, Harper R, Jones N, O’cathain A, Thomas K, et al. (1992) Validating the SF-36 health survey questionnaire: new outcome measure for primary care. BMJ 305: 160. doi: 10.1136/bmj.305.6846.160. Find this article online
20. 20. Maki KC, McKenney JM, Farmer MV, Reeves MS, Dicklin MR (2009) Indices of insulin sensitivity and secretion from a standard liquid meal test in subjects with type 2 diabetes, impaired or normal fasting glucose. Nutr J 8: 22. doi: 10.1186/1475-2891-8-22. Find this article online
21. 21. Ou H, Cheng J, Yu E, Wu T (2006) Metformin increases insulin sensitivity and plasma beta-endorphin in human subjects. Horm Metab Res 38: 106. doi: 10.1055/s-2006-925128. Find this article online
22. 22. Miyazaki Y, Matsuda M, DeFronzo RA (2002) Dose-response effect of pioglitazone on insulin sensitivity and insulin secretion in type 2 diabetes. Diabetes Care 25: 517–523. doi: 10.2337/diacare.25.3.517. Find this article online
23. 23. Ferrannini E (1998) Insulin resistance versus insulin deficiency in non-insulin-dependent diabetes mellitus: problems and prospects. Endocr Rev 19: 477–490. doi: 10.1210/er.19.4.477. Find this article online
24. 24. Gerich JE (1998) The genetic basis of type 2 diabetes mellitus: impaired insulin secretion versus impaired insulin sensitivity. Endocr Rev 19: 491–503. doi: 10.1210/er.19.4.491. Find this article online
25. 25. Derosa G, Franzetti IG, Querci F, Carbone A, Caccarelli L, et al. (2012) Exenatide plus metformin compared with metformin alone on β-cell function in patients with Type 2 diabetes. Diabet Med 29: 1515–1523. doi: 10.1111/j.1464-5491.2012.03699.x. Find this article online
26. 26. Degn KB, Juhl CB, Sturis J, Jakobsen G, Brock B, et al. (2004) One week’s treatment with the long-acting glucagon-like peptide 1 derivative liraglutide (NN2211) markedly improves 24-h glycemia and α-and β-cell function and reduces endogenous glucose release in patients with type 2 diabetes. Diabetes 53: 1187–1194. doi: 10.2337/diabetes.53.5.1187. Find this article online
27. 27. Wainstein J, Ganz T, Boaz M, Bar Dayan Y, Dolev E, et al. (2012) Olive leaf extract as a hypoglycemic agent in both human diabetic subjects and in rats. J Med Food 15: 605–610. doi: 10.1089/jmf.2011.0243. Find this article online
28. 28. Kim JH, Bachmann RA, Chen J (2009) Interleukin‐6 and Insulin Resistance. Vitam Horm 80: 613–633. Find this article online
29. 29. Carey AL, Steinberg GR, Macaulay SL, Thomas WG, Holmes AG, et al. (2006) Interleukin-6 increases insulin-stimulated glucose disposal in humans and glucose uptake and fatty acid oxidation in vitro via AMP-activated protein kinase. Diabetes 55: 2688–2697. doi: 10.2337/db05-1404. Find this article online
30. 30. Weigert C, Hennige AM, Lehmann R, Brodbeck K, Baumgartner F, et al. (2006) Direct cross-talk of interleukin-6 and insulin signal transduction via insulin receptor substrate-1 in skeletal muscle cells. J Biol Chem 281: 7060–7067. doi: 10.1074/jbc.M509782200. Find this article online
31. 31. Wheatcroft SB, Kearney MT, Shah AM, Ezzat VA, Miell JR, et al. (2007) IGF-binding protein-2 protects against the development of obesity and insulin resistance. Diabetes 56: 285–294. doi: 10.2337/db06-0436. Find this article online
32. 32. Heald A, Cruickshank J, Riste L, Cade J, Anderson S, et al. (2001) Close relation of fasting insulin-like growth factor binding protein-1 (IGFBP-1) with glucose tolerance and cardiovascular risk in two populations. Diabetologia 44: 333–339. doi: 10.1007/s001250051623. Find this article online
33. 33. Perrinjaquet‐Moccetti T, Busjahn A, Schmidlin C, Schmidt A, Bradl B, et al. (2008) Food supplementation with an olive (Olea europaea L.) leaf extract reduces blood pressure in borderline hypertensive monozygotic twins. Phytother Res 22: 1239–1242. doi: 10.1002/ptr.2455. Find this article online
34. 34. Susalit E, Agus N, Effendi I, Tjandrawinata RR, Nofiarny D, et al. (2011) Olive (Olea europaea) leaf extract effective in patients with stage-1 hypertension: comparison with Captopril. Phytomedicine 18: 251–258. doi: 10.1016/j.phymed.2010.08.016. Find this article online
35. 35. Fonolla J, Diaz-Ropero P, de la Fuente E, Quintela J (2010) One-month consumpotion of an olive leaf extract enhances cardivascular status in hypercholesterolemic subjects [abstract]. Atheroscler Suppl 11: 182 (MS358).

The standard lipid profile is the most basic and widely utilized screening tool in cardiovascular medicine. While an important component of overall assessment, approximately half of all individuals faced with a cardiovascular event had normal values on their lipid panel. This common test overlooks important structural and biochemical occurrences within the arterial wall. A rapidly expanding body of clinical research has clearly demonstrated that these underlying processes are valuable indicators of heart health.1-6Processes within the vasculature can be identified via biomarkers, molecules that serve as quantifiable indicators of biological homeostasis. Biomarker assessments are the instruments of personalized medicine because they enable evidence-based, individualized clinical evaluations based on reliable numerical values. In addition, they enable accurate monitoring of progress following changes in diet, lifestyle and nutritional supplement strategies.*The PureHeart™ ProtocolA collaboration between Pure Encapsulations and Cleveland HeartLab Inc. has coupled affordable biomarker tests with targeted nutritional supplement options. A CAP-accredited and CLIA-certified clinical reference laboratory, Cleveland HeartLab offers a series of cardiometabolic biomarker tests that have undergone extensive scientific validation and clinical research. These sensitive screening tools are now empowering physicians across the U.S. with the ability to determine the type of support, and a means to accurately assess progress. The PureHeart™ Protocol enables clinicians to match clinical objectives, based on test results, with the most effective products from Pure Encapsulations, simplifying and individualizing supplement approaches for maximum clinical results.* The Screening The Cleveland HeartLab advanced cardiometabolic biomarker profile includes six unique tests that measure biomarkers of cardiovascular health (Figure 1):* Myeloperoxidase (MPO) is an indicator of white blood cell activity and ensuing functional changes within the vasculature. Over the past decade, hundreds of published studies have validated MPO as a highly informative biomarker of total vascular health.1 This test can point to key objectives such as lipid balance, glucose homeostasis, vascular relaxation and optimizing coenzyme Q10 status.7* The PLAC® Test measures the vascular-specific enzyme lipoprotein-associated phospholipase A2 (Lp-PLA2). Levels of this enzyme reveal the activity of macrophages, reflecting the health of the arterial wall.2* Studies suggest that maintaining lipid homeostasis and blood flow help to keep this biomarker within a healthy range.8* High-sensitivity C-Reactive Protein (hsCRP) is an extremely sensitive measurement of C-reactive protein, a biomarker produced by the liver in response to cytokine activity anywhere in the cardiovascular system. This test can expedite decisions whether to evaluate and address potential underlying processes such as glucose homeostasis, vascular endothelial function and even dental health.3* Urinary microalbumin quantifies the amount of the serum protein albumin in urine, providing an indication of vascular endothelial integrity.4 This test can help in deciding whether to address related factors such as endothelial function and glucose metabolism.* F2-Isoprostanes (F2-IsoPs) and oxidized LDL (OxLDL). Oxidative stress plays an important role in cardiovascular health, and urinary F2-IsoPs quantify this on a systemic level.5 The extent to which oxidative status may be affecting functional proteins involved in lipid homeostasis can be determined through the oxidized LDL (OxLDL) test.6* Figure 1. Biomarkers that can be easily measured to determine vascular health. F2-IsoPs, OxLDL and hsCRP determine systemic oxidative stress and cytokine activity. Microalbumin, MPO and Lp-PLA2 specifically address the arterial wall and can indicate the need for advanced cardiovascular support.*   The Supplements Pure Encapsulations specializes in innovative, science-driven formulations for cardiometabolic health. This dedication integrates the most advanced bioavailability technologies with evidence-based ingredients.* Examples of supplements in The PureHeart™ Protocol include: Ultra-pure omega-3 fatty acids such as EPA/DHA essentials address multiple objectives pertaining to arterial health, lipid balance and metabolic homeostasis. Specialty formulas such as UltraKrill+D deliver EPA and DHA in the form of phospholipids in krill oil, with vitamin D3 and astaxanthin for added vascular support.9* Sustained-release and enhanced absorption coenzyme Q10 provides powerful support for endothelial function, oxygen utilization and bioenergetics of the heart and vasculature. Ubiquinol VESIsorb® contains the active form, ubiquinol, in a colloidal delivery system for enhanced absorption. SR-CoQ10 with PQQ provides 24-hour sustained-release CoQ10 in combination with PQQ, a B-vitamin-like antioxidant with a range of cardioprotective benefits.10* Resveratrol is a polyphenol that supports systemic antioxidant defenses, vascular endothelial relaxation and metabolic health. Resveratrol VESIsorb® and ResCu-SR™ deliver colloidal and sustained-release resveratrol, respectively, to enhance bioavailability and maximize clinical results. Metabolic Xtra combines pure, clinically researched resVida® resveratrol with alpha lipoic acid, berberine hydrochloride and chromium to support and maintain insulin receptor function and glucose homeostasis.11* Proprietary polyphenol blends have been developed as part of a long-term research collaboration between Pure Encapsulations and the Institute of Nutraceuticals and Functional Foods (INAF) based at Université Laval, Quebec, Canada.12 The cardiometabolic polyphenol platform emerging from this program includes Alpha Lipoic Acid w/GlucoPhenol™, which delivers alpha lipoic acid with strawberry and cranberry polyphenols that support glucose uptake in skeletal muscle. CranLoad™, a clinically researched blend of grape seed and cranberry extracts, supports nitric oxide synthesis and healthy flow-mediated dilation.13 Vascular Relax BP features CranLoad™ as part of a formula of polyphenols and magnesium to maximally support healthy endothelial function.* Screening + Supplements = Success™ With an ongoing dedication to heart health, Pure Encapsulations provides evidence-based formulations, advanced delivery technologies and unparalleled quality assurance. Based on objectives determined by screening, supplement support options can be selected using The PureHeart™ Protocol Guide. The Cleveland HeartLab tests are changing the way practitioners assess patients, select supportive avenues and monitor progress. By aligning reliable assessment tools and science-based product options, The PureHeart™ Protocol offers a simple solution to cardiometabolic care. For more information on the screening, visit visit www.clevelandheartlab.com.* References Brennan ML, Penn MS, Van Lente F, et al.  Prognostic value of myeloperoxidase in patients with chest pain. N Engl J Med (2003) 349(17):1595-1604. Kolodgie FD, Burke AP, Skorija KS, et al. Lipoprotein-associated phospholipase A2 protein expression in the natural progression of human coronary atherosclerosis.  Arterioscler Thromb Vasc Biol (2006) 26(11):2523-2529. Devaraj S, Singh U, Jialal I. Human C-reactive protein and the metabolic syndrome. Curr Opin Lipidol (2009) 20(3):182-189. Gerstein HC, Mann JF, Yi Q, et al. Albuminuria and risk of cardiovascular events, death, and heart failure in diabetic and nondiabetic individuals. JAMA (2001) 286(4):421-426. Schwedhelm E, Bartling A, Lenzen H, et al. Urinary 8-iso-prostaglandin F2 alpha as a risk marker in patients with coronary heart disease: a matched case-control study.  Circulation (2004) 109(7):843-848. Holvoet P, Lee DH, Steffes M, et al. Association between circulating oxidized low-density lipoprotein and incidence of the metabolic syndrome. JAMA (2008) 299:2287-2293. Andreou I, Tousoulis D, Miliou A, et al. Effects of rosuvastatin on myeloperoxidase levels in patients with chronic heart failure: a randomized placebo-controlled study. Atherosclerosis (2010) 210(1):194-198. Lee SH, Kang SM, Park S, et al. The effects of statin monotherapy and low-dose statin/ezetimibe on lipoprotein-associated phospholipase A. Clin Cardiol (2011) 34(2):108-112. Fassett RG, Coombes JS. Astaxanthin in cardiovascular health and disease.  Molecules (2012) 17(2):2030-2048. Zhu BQ, Zhou HZ, Teerlink JR, Karliner JS. Pyrroloquinoline quinone (PQQ) decreases myocardial infarct size and improves cardiac function in rat models of ischemia and ischemia/reperfusion. Cardiovasc Drugs Ther (2004) 18(6):421-431. Zhang H, Wei J, Xue R, et al. Berberine lowers blood glucose in type 2 diabetes mellitus patients through increasing insulin receptor expression.  Metabolism (2010) 59(2):285-292. Heim KC, Angers P, Léonhart S, Ritz BW. Anti-inflammatory and neuroactive properties of selected fruit extracts. J Med Food (2012) 15(9):851-854.

Abstract

1. Introduction

Pineapple is the common name of Ananas comosus (syns. A. sativus, Ananassa sativa, Bromelia ananas, B. comosa). Pineapple is the leading edible member of the family Bromeliaceae, grown in several tropical and subtropical countries including Philippines, Thailand, Indonesia, Malaysia, Kenya, India, and China. It has been used as a medicinal plant in several native cultures [1] and these medicinal qualities of pineapple are attributed to bromelain (EC 3.4.22.32), which is a crude extract from pineapple that contains, among other compounds, various closely related proteinases, exhibiting various fibrinolytic, antiedematous, antithrombotic, and anti-inflammatory activities in vitro and in vivo. Bromelain has been chemically known since 1875 and is used as a phytomedical compound [2]. Bromelain concentration is high in pineapple stem, thus necessitating its extraction because, unlike the pineapple fruit which is normally used as food, the stem is a waste byproduct and thus inexpensive [3]. A wide range of therapeutic benefits have been claimed for bromelain, such as reversible inhibition of platelet aggregation, sinusitis, surgical traumas [4], thrombophlebitis, pyelonephriti angina pectoris, bronchitis [5], and enhanced absorption of drugs, particularly of antibiotics [6, 7]. Several studies have been carried out indicating that bromelain has useful phytomedical application. However, these results are yet to be amalgamated and critically compared so as to make out whether bromelain will gain wide acceptance as a phytomedical supplement [8]. Bromelain acts on fibrinogen giving products that are similar, at least in effect, to those formed by plasmin [9]. Experiment in mice showed that antacids such as sodium bicarbonate preserve the proteolytic activity of bromelain in the gastrointestinal tract [10]. Bromelain is considered as a food supplement and is freely available to the general public in health food stores and pharmacies in the USA and Europe [11]. Existing evidence indicates that bromelain can be a promising candidate for the development of future oral enzyme therapies for oncology patients [12]. Bromelain can be absorbed in human intestines without degradation and without losing its biological activity [12, 13].

2. Biochemical Properties

The crude aqueous extract from stem and fruit of pineapple is known as bromelain. It is a mixture of different thiol endopeptidases and other components like phosphatases, glucosidase, peroxidases, cellulases, glycoproteins, carbohydrates, and several protease inhibitors [14]. Stem bromelain (EC.3.4.22.32) is different from fruit bromelain (EC.3.4.22.33) [15]. The enzymatic activities of bromelain comprise a wide spectrum with pH range of 5.5 to 8.0 [16]. Different protein fractions were obtained by mean of various “biochemical techniques as sodium dodecyl sulphate polyacrylamide gel electrophoresis” (SDS-PAGE), isoelectric focusing (IEF), and multicathodal-PAGE [17, 18]. Nowadays, bromelain is prepared from cooled pineapple juice by centrifugation, ultrafiltration, and lyophilization. The process yields a yellowish powder, the enzyme activity of which is determined with different substrates such as casein (FIP unit), gelatin (gelatin digestion units), or chromogenic tripeptides [7, 17, 19, 20].

3. Absorption and Bioavailability

The body can absorb significant amount of bromelain; about 12gm/day of bromelain can be consumed without any major side effects [13]. Bromelain is absorbed from the gastrointestinal tract in a functionally intact form; approximately 40% of labeled bromelain is absorbed from intestine in high molecular form [21]. In a study carried out by Castell et al. [13] bromelain was detected to retain its proteolytic activity in plasma and was also found linked with alpha 2-macroglobulin and alpha1-antichymotrypsin, the two antiproteinases of blood. In a recent study, it was demonstrated that 3.66mg/mL of bromelain was stable in artificial stomach juice after 4hrs of reaction and also 2.44mg/mL of bromelain remained in artificial blood after 4hrs of reaction [22].

4. Medicinal Uses

Clinical studies have shown that bromelain may help in the treatment of several disorders.

5. Conclusion

Bromelain has a wide range of therapeutic benefits, but the mode of its action is not properly understood. It is proved that bromelain is well absorbed in body after oral administration and it has no major side effects, even after prolonged use. All the evidences reviewed in this paper suggest that bromelain can be used as an effective health supplement to prevent cancer, diabetes, and various cardiovascular diseases in the long run.

6. Future Trends and Perspectives

Bromelain can be a promising candidate for the development of oral enzyme therapies for oncology patients. It is clear from this paper that bromelain is a multiaction enzyme; however, more research is required to understand the proper mechanism of action of bromelain so that the multiaction activities of bromelain can be harnessed efficiently.

Acknowledgments

References

Edilberto A Rocha Filho^*, José C Lima, João S Pinho Neto and Ulisses Montarroyos

Sebastiano Banni^1,2*, Gianfranca Carta^1,2, Elisabetta Murru^1,2, Lina Cordeddu^1,2, Elena Giordano^1,2, Anna R Sirigu^1,2, Kjetil Berge³, Hogne Vik³, Kevin C Maki⁴, Vincenzo Di Marzo⁵ and Mikko Griinari⁶

¹Department of Internal Medicine, Institute of Medicine, Sahlgrenska Academy, University of Gothenburg, Gothenburg, Sweden

Correspondence: Riadh Sadik, MD, PhD, Department of Internal Medicine, Institute of Medicine, Sahlgrenska Academy, University of Gothenburg, Gothenburg, SE 413 45, Sweden. E-mail: riadh.sadik@vgregion.se

Received 3 August 2010; Accepted 18 November 2010; Published online 4 January 2011.

Top of page

Abstract

Top of page

INTRODUCTION

Irritable bowel syndrome (IBS) is a common functional gastrointestinal (GI) disorder (1,2,3), characterized by abdominal pain/discomfort related to altered bowel habits in the absence of organic cause (4). GI disorders affect health-related quality of life (HRQOL) negatively. This negative effect is more pronounced in functional GI disorders compared with organic GI disorders (5). Moreover, patients with IBS have a higher prevalence of migraine, fibromyalgia, and depression (6), and fatigue is often a prominent symptom (7).

Physical activity is beneficial to prevent or treat a number of conditions, such as depression (8), fibromyalgia (9), and colon cancer (10,11). Increases in maximal cardiorespiratory fitness and habitual physical activity are associated with less severe depressive symptoms and greater emotional well-being (12).

Physical activity has been shown to improve gas transit and abdominal distension in healthy subjects, but not the perception of bloating (13). Regular physical activity improves defecation pattern and colonic transit time in patients complaining of chronic constipation (14). On the other hand, endurance athletes have been reported to complain of GI symptoms (15). Symptoms such as bloating, diarrhea, flatulence, and nausea are well documented in these athletes (16).

In a questionnaire survey by Lustyk et al., it was shown that women suffering from IBS are less physically active than are healthy women. Women with IBS who were physically active reported less fatigue and less feelings of incomplete evacuation. However, in this study, it could not be determined whether IBS prevented these women from being physically active or whether being physically inactive worsened their symptoms (17). In educational programs for IBS, patients are advised to be more physically active or to exercise, although it has so far not been explored whether physical activity is beneficial in IBS (18).

Therefore, the primary aim of this study was to test the hypothesis that increased physical activity decreases the severity of IBS symptoms. The secondary aims were to assess the impact of physical activity on quality of life (QOL), psychological symptoms, and fatigue in IBS patients and also on oroanal transit.

Top of page

METHODS

Subjects

A total of 162 patients with a clinical diagnosis of IBS, based on the ROME II criteria (4), were invited to participate in the study. Patients were referred from gastroenterology units at community hospitals and a university hospital in Västra Götalandsregion, Sweden. They were recruited from June 2005 until March 2008, and data collection was performed from August 2005 until August 2008. To be included in the study, subjects had to be able to increase their level of physical activity. Exclusion criteria were age younger than 18 years, pregnancy, organic GI disorders, and respiratory or cardiac disease. Patients were contacted through telephone and given information by a physiotherapist before the randomization visit.

All subjects gave informed consent, and the study was approved by the ethics committee and by the radiation safety committee of the University of Göteborg. The consort guidelines were followed.

Randomization

At the randomization visit, the exclusion and inclusion criteria were reviewed by a gastroenterologist (RS) and by the physiotherapist (EJ). Patients were then randomized to the physical activity group or to the control group. To allocate an equal number of patients to both groups, randomization was carried out in blocks of four patients, in which two out of four were randomized to the physical activity group by pulling a card out of an envelope. The randomization and dropouts are shown in the flow chart below (Figure 1).

Intervention

The physical activity group had regular telephone contact once or twice a month with a physiotherapist who gave individual advice regarding physical activity during 12 weeks. To encourage and stimulate patients to increase their physical activity, they completed a training diary and performed a cycle test after 6 weeks.

The aim of this intervention was to moderately increase the level of physical activity to an extent that would have a positive effect on oxygen uptake. The advice followed the Swedish National Institute of Public Health publication, Physical Activity in the Prevention and Treatment of Disease (19), which is a guide for prescribing physical activity. The recommendation for increasing cardiorespiratory fitness is 20–60 min of moderate-to-vigorous intensive physical activity 3 to 5 days per week. These recommendations are based on the review from the American College of Sports Medicine (20). Patients were given individual advice depending on their previous level of physical activity and experience of exercise. The activities suggested could be any activity depending on individual factors, such as time, opportunities, or costs.

The control group was encouraged to maintain their lifestyle. They also had a supportive telephone contact with the physiotherapist once a month. After 12 weeks, controls were offered the same intervention as the physical activity group to increase their physical activity level (results not reported in this article).

Questionnaires

The IBS-SSS. The IBS Severity Scoring System (IBS-SSS) (21) consists of visual analog scales and is divided into two subscales, namely an overall IBS score and an extracolonic score. The IBS score contains questions regarding pain severity, pain frequency, abdominal bloating, bowel habit dissatisfaction, and life interference. The extracolonic score contains questions regarding vomiting, gas, belching, satiety, headache, fatigue, musculoskeletal pain, heartburn, dysuria, and urgency. Each subscale ranges from 0 to 500, with higher scores meaning more severe symptoms. A reduction of 50 is considered to be adequate to detect a clinical improvement (21).

IBS-QOL. The IBS-QOL is a disease-specific instrument measuring HRQOL. It consists of 30 items, which measures 9 dimensions of emotional functioning, mental health, sleep, energy, physical functioning, diet, social role, physical role, and sexual relations. For each subscale, the scores are transformed to range from 0 to 100, 100 representing the best possible HRQOL (22,23).

Short Form-36. Short Form-36 was used to assess the general HRQOL. It includes 36 items, which are divided into 8 subscales, namely physical functioning, physical role, body pain, general health perceptions, vitality, social functioning, emotional role, and mental health. For each subscale, the raw scores are transformed into a scale from 0 to 100, where 100 represents the best possible HRQOL (24,25).

The HADS. The HADS (Hospital Anxiety and Depression Scale) was developed for medical outpatients (26) and consists of 14 items, each using a 4-graded Likert’s scale (0–3). The scale is divided into two subscales, anxiety and depression. Each subscale ranges from 0 to 21, where high score means more severe symptoms.

The Fatigue Impact Scale. This scale was initially developed for patients with chronic fatigue syndrome (27) and has previously been used in studies in IBS patients (7). The scale consists of 40 questions divided into 3 subscales, physical functioning (10 items), cognitive functioning (10 items), and psychosocial functioning (20 items). Subjects are asked to rate to which extent fatigue has caused problems for them during the previous month. Each item consists of a statement and the subject should rate 0 to 4, where 0 means “no problem” and 4 means “extreme problem.”

Measurements

The following measurements were performed at the time of inclusion and 12 weeks later:

Weight: Weight was measured to the nearest 0.1 kg.

Oxygen uptake: Oxygen uptake was calculated from a submaximal cycle (Monark Ergomedic 839, Monark Exercise AB, Kroons väg 1, Vansbro, Sweden). The ergometer test was conducted according to the study by Astrand and Ryhming (28).

Oroanal transit time: To measure oroanal transit time (29), patients ingested 10 radiopaque markers for 6 days. On the seventh day, the markers were counted using fluoroscopy. The oroanal transit time was calculated in days by dividing the number of retained radiopaque markers by 10, i.e., the daily dose.

Bristol Stool Form Scale: Patients recorded their bowel movements during the week before the visits to the laboratory. They recorded all bowel movements and its consistency according to the Bristol Stool Form Scale (30).

Training diary: The training diary is a non-validated form filled out by the physical activity group every day during the 12-week period. Patients reported performed activity, duration, and estimated intensity. The diary was used only to stimulate patients to be physically active and to know the type of physical activity they were performing.

Data analysis and statistics

The primary end point was between-group differences in the change in IBS-SSS scores from the 12-week follow-up visit relative to baseline. The secondary end points were to assess whether changes in the other questionnaires assessing QOL, anxiety, depression, and fatigue differed between the groups. Other secondary end points were changes in weight, oxygen uptake, oroanal transit, and Bristol Stool Form Scale.

Within-group comparison were also performed for exploratory reasons. A per-protocol analysis of data obtained from patients completing the study was performed. We also performed an intention-to-treat analysis that is reported separately in the results. The results are presented as median, and percentile 10 and 90. Analyses used on the data with normal distribution were paired and unpaired t-tests. The t-test was used only for oxygen uptake. The results from the questionnaires were considered as ordinal data, and therefore, analyses were performed using Wilcoxon’s signed rank test and Mann–Whitney U-test. McNemar’s exact test was used to assess the difference between the physical activity group and the control group regarding the proportion of patients with decreased or increased IBS symptoms. Significance was accepted at the 5% level (<0.05). For statistical analyses, we used SPSS version 14.0 (SPSS, IBM Corporation, NY). The study has not been registered on a regulatory agency.

RESULTS

Subjects

A total of 162 patients were assessed for participation in the study. In all, 60 (89% women, median age 33 (17–67) years) patients were not included because of the reasons shown in the flow chart (Figure 1). Overall, 20 patients could not increase their level of physical activity, as they were already physically active (Figure 1). More than half of this group claimed that physical activity helped them to handle their IBS symptoms. All in all, 102 (79% women, median age 38.5 (18–77) years) patients fulfilled the inclusion criteria and were included in the study. There were 13 dropouts in the physical activity group. Four of these dropouts did not attend the first test and could not be included in the intention-to-treat analysis. Therefore, 46 patients in the physical activity group could be included in the intention-to-treat analysis. In the control group, there were 14 dropouts (Figure 1). Seven of these dropouts did not attend the first test and could not be included in the intention-to-treat analysis. Overall, 45 patients in the control group could be included in the intention-to-treat analysis (Figure 1). In both groups, the main reason for dropout was lack of time: 6 (42.8%) subjects in the control group and 7 (53.8%) subjects in the physical activity group.

A total of 75 patients (75% women, median age 38 (18–65) years) completed the study and could be included in the per-protocol analysis. In all, 22 were classified as diarrhea-predominant IBS, 20 as constipation-predominant IBS, and 33 as the alternating-type IBS.

A total of 38 (73.7% women, median age 38.5 (19–65) years) patients in the control group and 37 (75.7% women, median age 36 (18–65) years) patients in the physical activity group completed the study.

The details of randomization are shown in the (Figure 1).

Table 1 shows the demographic data for the 75 patients completing the study.

Table 1 – Demographic data.

Full table

Per-protocol analysis. The IBS-SSS: There was a significant difference in the improvement in the overall IBS score between the physical activity group and the control group (−51 (−130 and 49) vs. −5 (−101 and 118), P=0.003). There was no significant difference between the groups in the improvement in the extracolonic score (−36 (−99 and 52) vs. −19 (−70 and 113), P=NS). As shown in Figures 2 and 3, the physical activity group improved significantly in both subscales of the IBS-SSS, which was not the case in the control group.

Table 2 shows the proportion of patients in each group with a clinically significant change of the IBS-SSS of >50 points. The table shows that the proportion of patients with increased IBS symptom severity is significantly larger in the control group than in the physical activity group. Moreover, the proportion of patients showing improvement in the overall IBS score tended to be larger in the physical activity group than in the control group.

Other measurements and questionnaires: There was a significant difference between the groups in the improvement in disease-specific QOL dimensions of physical functioning and physical role at the 12-week visit relative to baseline (Table 3) with greater improvement in the physical activity group.

As shown in Table 4, in the physical activity group, the disease-specific QOL (IBS-QOL) improved significantly in dimensions of emotion, sleep, energy, physical functioning, social, and physical role, whereas mental health, diet, and sexual relations were not affected.

The control group demonstrated improvements in dimensions of emotion, diet, and social role, but the dimensions of mental health, sleep, energy, physical function, physical role, and sexual relations were not affected (Table 4).

As shown in Table 5, the parameters body weight, oroanal transit time, self-reported bowel movements, and stool consistency showed no significant changes between or within the groups. As shown in Tables 6, 7 and 8, Short Form-36, HADS, and the Fatigue Impact Scale showed no significant changes between or within the groups.

Oxygen uptake and training diary: There was no significant change in oxygen uptake between the groups. Oxygen uptake increased significantly in the physical activity group, from 2.36 (1.51 and 3.23) to 2.47 (1.80 and 3.28) liter per minute (P=0.02), whereas there was no significant change in the control group, from 2.24 (1.41 and 3.20) to 2.20 (1.65 and 3.22) liter per minute. The five most common activities reported in the training diaries were walking, cycling, swimming, running/jogging, and Nordic walking.

Intention-to-treat analysis. A total of 46 patients in the physical activity group and 45 in the control group were included in this analysis. The significant changes found in the per-protocol analysis are also found in the intention-to-treat analysis.

The IBS-SSS: There was a significant difference in the improvement in the overall IBS score between the physical activity group and the control group (−37 (−142 and 37) vs. 0 (−97 and 109), P=0.014). There was no significant difference between the groups in the improvement in the extracolonic score (−13 (−97 and 59) vs. −14 (−67 and 90), P=NS).

IBS score: The physical activity group changed from 292 (133 and 371) to 246.0 (104 and 371) (P=0.001).

The control group changed from 270 (151 and 362) to 255 (134 and 373) (P=NS).

Extracolonic score: The physical activity group changed from 194 (97 and 304) to 173 (56 and 294) (P=0.013).

The control group changed from 187 (72 and 295) to 176 (75 and 316) (P=NS).

IBS-QOL: There was a significant difference between the groups in the improvement in the disease-specific QOL dimensions of physical function (0 (−37 and 20) vs. 8 (−3 and 28), P=0.01) and physical role (0 (−40 and 31) vs. 0 (−14 and 50), P=0.03) at the 12 week-visit relative to baseline, with greater improvement in the physical activity group.

The oxygen uptake: There was no significant change in oxygen uptake between the groups. The physical activity group changed from 2.35 (1.56 and 3.35) to 2.44 (1.74 and 3.34) liter per minute (P=0.02). The control group changed from 2.22 (1.48 and 3.35) to 2.16 (1.66 and 3.22) liter per minute (P=NS).

Top of page

DISCUSSION

This prospective, randomized, controlled, open-label study shows that increased physical activity decreases the severity of IBS symptoms and improves some dimensions of QOL in IBS patients. Moreover, increasing the severity of IBS symptoms was significantly less prevalent in the physically active group than in the control group.

This study presents the first application of physical activity as a treatment modality for IBS. Moreover, the presented results are clinically applicable without requiring costly resources or very high efforts.

This study supports the advice to increase physical activity in IBS. In several publications (18,31,32), it has been suggested that advice on physical activity may be given to IBS patients. However, it has not been previously shown that physical activity has a positive effect on the symptoms in IBS. Moreover, the current study shows that the risk of symptom deterioration is significantly higher in physically inactive IBS patients. This is also an important message to patients that their symptoms may increase if they are physically inactive.

The findings of the positive effect of physical activity on GI symptoms in the current study supports previous results indicating a protective effect of physical activity on GI symptoms (13,14,17,33). Levy et al. (33) stated the hypotheses that GI symptoms could be inversely related to behaviors that reduce obesity risk, such as high exercise, low fat intake, and high fruit/vegetable intake. Their main finding was that a higher level of physical activity was protective against GI symptoms in obese individuals. Lustyk et al. (17) discussed whether it was IBS that stopped the women from being physically active or if being inactive worsened the symptoms. Our results support the theory that being inactive worsens IBS symptoms.

The main reason for not being included in our study was the inability to increase physical activity as shown in the flow chart (Figure 1). When contacting these patients to evaluate the possibility to include them in the study, more than half of them reported that they were physically active and that activity improved their symptoms. Only 2 out of the 102 included patients had a negative experience of physical activity because of their IBS and those 2 still wanted to participate in the study. Perhaps it is more important to find another type of activity instead of stopping the training if the patient had a bad experience. Patients included in our study were those who could increase their level of physical activity. We have not studied patients who already practiced a very high level of physical activity. Long-distance runners, cyclists, and triathletes often report GI symptoms during exercise (16). Therefore, it is important to carefully analyze the history of IBS patients to assess the level of their physical activity before giving them advice on increased physical activity.

The mechanisms behind the improvement in the physical activity group are unknown. We may speculate that some of the improvement can probably be explained by the fact that stress induces exaggeration of the neuroendocrine response and visceral perceptual alterations (34), whereas physical activity counteracts the effects of stress (35). Physical activity can favorably influence brain plasticity by facilitating neurogenerative, neuroadaptive, and neuroprotective processes (35). This influence on the central nervous system may have a positive effect on the brain–gut axes that is involved in IBS. Villoria et al. (36) showed that mild physical activity enhances intestinal gas clearance and reduces symptoms in patients complaining of abdominal bloating. The same group showed earlier that physical activity improves gas transit and abdominal distension in healthy subjects, but not the perception of bloating (13). This may also explain the improvement in symptoms shown in this study. The improvement in constipation-predominant IBS can be due to the positive effects of physical activity on symptoms of constipation (14).

The improvements we observed in the physical activity group in disease-specific QOL were in the dimensions of physical function and physical role. This is not surprising as the physical activity group was more physically active.

In the current study, we did not see an improvement in overall HRQOL, which might be due to the relatively short time of follow-up. It has been shown that long-term physical activity patterns are an important determinant of HRQOL in women (37). Our data may indicate that the improvement in GI symptoms may occur faster and before the eventual improvement in HRQOL as we were unable to show an improvement in overall HRQOL after 12 weeks. Longer future studies may be able to show such improvements in HRQOL or even in other parameters, such as fatigue.

The improvement in cardiorespiratory fitness in the training group was reflected in the increase in oxygen uptake. This increase was significant but not high. The reason for that is that the increase in physical activity was light to moderate and that not all physical activities improve cardiorespiratory fitness. The improvement in symptoms in this group implies that even a light-to-moderate increase in physical activity is useful and should be recommended according to our data. Although patients were encouraged to perform more vigorous activities, the most common activity was walking which in most cases was used as a complement to other physical activities.

It is possible that the amount of attention and support the patients received in our study was not high enough to increase oxygen uptake more than we have shown. Home-based training and advice on increased physical activity is cheap, and we designed the study so that the results can be easily applied in clinical practice. Blumenthal et al. designed a study of major depression in which there were four groups, one which received medical intervention, one placebo group, and two physical activity groups. One of the active groups received supervised physical activity and the other one had home-based physical activity. Both active groups and the medication group achieved higher remission of depression than did the placebo group (8). These data support the appropriateness of our study design.

One general feature of IBS treatment studies is that there is a placebo effect of the treatment. Physical activity cannot be given in a blinded manner. In our study, the control group was also receiving regular support through telephone calls. However, the placebo effect is probably involved in the effect of physical activity and all other treatments given for this patient group. Similar positive results were observed in the per-protocol analysis and in the intention-to-treat analysis. Light-to-moderate physical activity is cheap and also has general positive health effects. Physical activity should therefore be recommended as a primary treatment for these patients.

The potential weakness of this study is the number of dropouts. However, the number of dropouts in the two groups was comparable. Moreover, the number of patients in each IBS bowel habit subgroup was not sufficient to perform a subgroup analysis. This should be addressed in future studies. The exercise program was not strictly supervised, but this is in fact what happens in the real world. The data may therefore be applicable for the daily clinical practice. The mechanisms behind symptom improvement cannot be assessed from this study. Further studies are required to address these mechanisms.

In conclusion, increased physical activity improves GI symptoms and some aspects of disease-specific HRQOL in IBS. Physically active IBS patients have a lower risk of experiencing symptom deterioration than do physically inactive patients. Physical activity should be used as a primary treatment modality in IBS. However, there is a need for future studies on physical activity in IBS. We need to expand our knowledge about the type, frequency, duration, and intensity of physical activity, which gives the best effect. The effect of physical activity on different subtypes of IBS also deserves further studies.

Top of page

STUDY HIGHLIGHTS

Top of page

Conflict of interest

Guarantor of the article: Riadh Sadik, MD, PhD.

Specific author contributions: All the authors were involved in the planning and conduct of this study. All authors were involved in the writing of this manuscript and have discussed, changed, and accepted the final version.

Financial support: This study was supported by the Health and Medical Care Executive Board of the Västra Götaland Region and by the Research and Development Council in Södra Älvsborg, Sweden.

Potential competing interests: None.

Top of page

References

1. Vandvik PO, Lydersen S, Farup PG. Prevalence, comorbidity and impact of irritable bowel syndrome in Norway. Scand J Gastroenterol 2006;41:650–656.
2. Hillila MT, Farkkila MA. Prevalence of irritable bowel syndrome according to different diagnostic criteria in a non-selected adult population. Aliment Pharmacol Ther 2004;20:339–345.
3. Wilson S, Roberts L, Roalfe A et al. Prevalence of irritable bowel syndrome: a community survey. Br J Gen Pract 2004;54:495–502.
4. Thompson WG, Longstreth GF, Drossman DA et al. Functional bowel disorders and functional abdominal pain. Gut 1999;45 (Suppl 2): II43–II47.
5. Simren M, Svedlund J, Posserud I et al. Health-related quality of life in patients attending a gastroenterology outpatient clinic: functional disorders versus organic diseases. Clin Gastroenterol Hepatol 2006;4:187–195.
6. Cole JA, Rothman KJ, Cabral HJ et al. Migraine, fibromyalgia, and depression among people with IBS: a prevalence study. BMC Gastroenterol 2006;6:26.
7. Simren M, Abrahamsson H, Svedlund J et al. Quality of life in patients with irritable bowel syndrome seen in referral centers versus primary care: the impact of gender and predominant bowel pattern. Scand J Gastroenterol 2001;36:545–552.
8. Blumenthal JA, Babyak MA, Doraiswamy PM et al. Exercise and pharmacotherapy in the treatment of major depressive disorder. Psychosom Med 2007;69:587–596.
9. Mannerkorpi K. Exercise in fibromyalgia. Curr Opin Rheumatol 2005;17:190–194.
10. Steindorf K, Jedrychowski W, Schmidt M et al. Case-control study of lifetime occupational and recreational physical activity and risks of colon and rectal cancer. Eur J Cancer Prev 2005;14:363–371.
11. Wolin KY, Lee IM, Colditz GA et al. Leisure-time physical activity patterns and risk of colon cancer in women. Int J Cancer 2007;121:2776–2781.
12. Galper DI, Trivedi MH, Barlow CE et al. Inverse association between physical inactivity and mental health in men and women. Med Sci Sports Exerc 2006;38:173–178.
13. Dainese R, Serra J, Azpiroz F et al. Effects of physical activity on intestinal gas transit and evacuation in healthy subjects. Am J Med 2004;116:536–539.
14. De Schryver AM, Keulemans YC, Peters HP et al. Effects of regular physical activity on defecation pattern in middle-aged patients complaining of chronic constipation. Scand J Gastroenterol 2005;40:422–429.
15. Peters HP, De Vries WR, Vanberge-Henegouwen GP et al. Potential benefits and hazards of physical activity and exercise on the gastrointestinal tract. Gut 2001;48:435–439.
16. Peters HP, Bos M, Seebregts L et al. Gastrointestinal symptoms in long-distance runners, cyclists, and triathletes: prevalence, medication, and etiology. Am J Gastroenterol 1999;94:1570–1581.
17. Lustyk MK, Jarrett ME, Bennett JC et al. Does a physically active lifestyle improve symptoms in women with irritable bowel syndrome? Gastroenterol Nurs 2001;24:129–137.
18. Colwell LJ, Prather CM, Phillips SF et al. Effects of an irritable bowel syndrome educational class on health-promoting behaviors and symptoms. Am J Gastroenterol 1998;93:901–905.
19. Jansson E. Allmänna rekommendationer om fysisk aktivitet. In Ståhle A (ed.) Physical Activity in the Prevention and Treatment of Disease. Swedish National Institute of Public Health: Sandviken, 2003, 65–71.
20. American College of Sports Medicine Position Stand. The recommended quantity and quality of exercise for developing and maintaining cardiorespiratory and muscular fitness, and flexibility in healthy adults. Med Sci Sports Exerc 1998;30:975–991.
21. Francis CY, Morris J, Whorwell PJ. The irritable bowel severity scoring system: a simple method of monitoring irritable bowel syndrome and its progress. Aliment Pharmacol Ther 1997;11:395–402.
22. Hahn BA, Kirchdoerfer LJ, Fullerton S et al. Evaluation of a new quality of life questionnaire for patients with irritable bowel syndrome. Aliment Pharmacol Ther 1997;11:547–552.
23. Watson ME, Lacey L, Kong S et al. Alosetron improves quality of life in women with diarrhea-predominant irritable bowel syndrome. Am J Gastroenterol 2001;96:455–459.
24. Sullivan M, Karlsson J, Ware JE Jr. The Swedish SF-36 Health Survey—I. Evaluation of data quality, scaling assumptions, reliability and construct validity across general populations in Sweden. Soc Sci Med 1995;41:1349–1358.
25. Sullivan M , Karlsson J, Ware JE. Hälsoenkät Manual och Tolkningsguide (SF-36 Health Survey, Swedish Manual and Interpretation Guide). Sahlgrenska Universtity Hospital: Göteborg, 2002.
26. Zigmond AS, Snaith RP. The Hospital Anxiety and Depression Scale. Acta Psychiatr Scand 1983;67:361–370.
27. Fisk JD, Ritvo PG, Ross L et al. Measuring the functional impact of fatigue: initial validation of the fatigue impact scale. Clin Infect Dis 1994;18 (Suppl 1): S79–S83.
28. Astrand PO, Ryhming I. A nomogram for calculation of aerobic capacity (physical fitness) from pulse rate during sub-maximal work. J Appl Physiol 1954;7:218–221.
29. Sadik R, Abrahamsson H, Stotzer PO. Gender differences in gut transit shown with a newly developed radiological procedure. Scand J Gastroenterol 2003;38:36–42.
30. Lewis SJ, Heaton KW. Stool form scale as a useful guide to intestinal transit time. Scand J Gastroenterol 1997;32:920–924.
31. Wilson JF. In the clinic. Irritable bowel syndrome. Ann Intern Med 2007;147:ITC7-1–ITC7-16.
32. Bengtsson M, Ulander K, Borgdal EB et al. A course of instruction for women with irritable bowel syndrome. Patient Educ Couns 2006;62:118–125.
33. Levy RL, Linde JA, Feld KA et al. The association of gastrointestinal symptoms with weight, diet, and exercise in weight-loss program participants. Clin Gastroenterol Hepatol 2005;3:992–996.
34. Posserud I, Agerforz P, Ekman R et al. Altered visceral perceptual and neuroendocrine response in patients with irritable bowel syndrome during mental stress. Gut 2004;53:1102–1108.
35. Dishman RK, Berthoud HR, Booth FW et al. Neurobiology of exercise. Obesity 2006;14:345–356.
36. Villoria A, Serra J, Azpiroz F et al. Physical activity and intestinal gas clearance in patients with bloating. Am J Gastroenterol. 2006;101:2552–2557.
37. Wolin KY, Glynn RJ, Colditz GA et al. Long-term physical activity patterns and health-related quality of life in US women. Am J Prev Med 2007;32:490–499.

Thanyaluck Phitak, Peraphan Pothacharoen and Prachya Kongtawelert^*

Abstract

Background

Glucosamine (GlcN) is a well-recognized candidate for treatment of osteoarthritis. However, it is currently used in derivative forms, such as glucosamine-hydrochloride (GlcN-HCl) or glucosamine sulfate (GlcN-S). However, the molecular mode of action remains unclear. In this study, we compared the effects of Glucose (Glc), Glucuronic acid (GlcA), Glucosamine hydrochloride (GlcN-HCl) and Glucosamine sulfate (GlcN-S) on cartilage degradation.

Methods

Porcine cartilage explants were co-cultured with recombinant human IL-1β and each tested substance for 3 days. HA, s-GAG and MMP-2 releases to media were measured using ELISA, dye-binding assay and gelatin zymography, respectively. Similar studies were performed in a human articular chondrocytes (HAC) monolayer culture, where cells were co-treated with IL-1β and each reagent for 24 hours. Subsequently, cells were harvested and gene expression measured using RT-PCR. All experiments were carried out in triplicate. Student’s t-tests were used for statistical analysis.

Results

In cartilage explants treated with IL-1β, GlcN-S had the highest chondroprotective activity of all four chemicals as shown by the inhibition of HA, s-GAG and MMP-2 released from cartilage. The anabolic (aggrecan core protein; AGG, SOX9) and catabolic (MMP-3, -13) genes in HACs treated with IL-1β and with/without chemicals were studied using RT-PCR. It was found that, GlcN-HCl and GlcN-S could reduce the expression of both MMP-3 and -13 genes. The IL-1β induced-MMP-13 gene expression was decreased maximally by GlcN-S, while the reduction of induced-MMP-3 gene expression was greatest with GlcN-HCl. Glc and GlcA reversed the effect of IL-1β on the expression of AGG and SOX9, but other substances had no effect.

Conclusion

This study shows that glucosamine derivatives can alter anabolic and catabolic processes in HACs induced by IL-1β. GlcN-S and GluN-HCl decreased induced MMP-3 and -13 expressions, while Glc and GlcA increased reduced-AGG and SOX9 expression. The chondroprotective study using porcine cartilage explant showed that GlcN-S had the strongest effect.

Background

Osteoarthritis (OA) is the most common form of arthritis, and is a public health problem throughout the world. OA is characterized by cartilage deterioration, as evidenced by quantitative and qualitative modification of proteoglycans (PGs) and collagen. An imbalance between the biosynthesis and the degradation of matrix components leads to a progressive destruction of the tissue, resulting in extensive articular damage [1].

Glucosamine (GlcN) is becoming increasingly popular as an alternative treatment for OA. GlcN is an aminosaccharide, acting as a preferred substrate for the biosynthesis of glycosaminoglycan chains and subsequently, for the production of aggrecan and other proteoglycans found in cartilage [2]. There is evidence that GlcN is equally effective or even better in decreasing pain in patients with knee OA, as compared to low dose Non-Steroidal Anti-Inflammatory Drug (NSAID) use [3,4]. Several clinical studies have indicated that crystalline GlcN-S is effective in controlling OA symptoms and disease progression [5-7]. In addition, the study of GlcN levels in plasma and synovial fluid suggests that GlcN is bioactive both systemically and at the site of action (joint) after oral administration of crystalline GlcN-S [8]. Although the treatment of OA with GlcN is quite popular, the exact mechanism of its effects on cartilage and chondrocytes, especially at the molecular level, remains unknown. There are many reports demonstrating the effect of GlcN and suggesting that GlcN reverses the decrease in proteoglycan synthesis and in UDP-glucuronosyl-transferase I mRNA expression induced by IL-1β [9]. Moreover, addition of GlcN to rat chondrocytes treated with IL-1β decreased the activation of the nuclear factor κB, but not the activator protein-1; GlcN can also increase the expression of mRNA encoding the type II IL-1β receptor (a decoy receptor) [10]. In human osteoarthritic chondrocytes, it was found that GlcN-S inhibits the synthesis of proinflammatory mediators stimulated by IL-1β through a NFκB-dependent mechanism [11]. Furthermore, the study of anabolic and catabolic gene expression in human osteoarthritic explants revealed that GlcN-HCl and GlcN-S downregulated both anabolic and catabolic gene expression [12]. Thus, the therapeutic effects of GlcN may be due to anti-catabolic activities, rather than due to anabolic activities.

GlcN used for OA treatment is mostly GlcN derivatives, such as GlcN-HCl and Glc-S. There are some reports that compare the effects of these derivatives. It was found that GlcN-S is a stronger inhibitor of gene expression than GlcN-HCl [13]. However, there has to date been no comparison of the chondroprotective effects of GlcN derivatives. In this study, we compared the chondroprotective effects of GlcN-HCl, GlcN-S, Glc and GlcA in porcine cartilage explants and human articular chondrocytes (HAC) that had been induced by IL-1β. Since the metabolic imbalance in OA includes both an increase in cartilage degradation and insufficient reparative or anabolic response [14], the effects of these glucose derivatives, on both catabolic and anabolic gene expression, were studied and compared in HAC treated with IL-1β.

Methods

Chemicals

The following chemicals were purchased from Sigma-Aldrich (USA): D-(+)-Glucose, D-(+)-Glucuronic acid γ-lactone, and D-(+)-Glucosamine hydrochloride. GlcN-S was obtained from Rottapharm and IL-1β was purchased from R&D (R&D system, USA).

Preparation and treatment of cartilage explants

The cartilage degradation model was performed using porcine cartilage explant induced inflammation using IL-1β as described previously [15-17]. Briefly, the metacarpophalangeal joints were dissected for articular cartilage from 20-24 week-old pigs. These were then incubated in serum-free Dulbecco’s modified Eagle’s medium (DMEM) containing 200 units/ml of penicillin and 200 ug/ml of streptomycin with 5% CO₂ and at 37°C. The explants were kept for 24 hours. Recombinant human interleukin-1β (25 ng/ml) was used to induce cartilage degradation. The explants were subsequently co-treated with IL-1β and various concentrations of Glc, GlcN-S, GlcA and GlcN-HCl (20, 40, 80 mM). The media were collected on the third day of the treatment and stored at -20°C for further analysis. It should be noted that all experiments were performed in triplicate using tissue from one animal donor.

HAC culture and treatment

Primary chondrocytes were isolated from the non-inflammatory human cartilage that was collected after arthroscopic diagnosis of flat-pad syndrome patients at the Maharaj Nakorn Chiang Mai Hospital. Fully informed written consent was obtained from each patient and the study was approved by the Research Ethics Committee 3, Faculty of Medicine, Chiang Mai University (ethics approval code is 070CT111016). The cartilage was digested with trypsin at 4°C for 12 hours, and with collagenase (Sigma-Aldrich^®, type IA) at 37°C for 3 hours. Then, the cells were washed with phosphate-buffered saline (PBS) and grown at high density in a monolayer culture comprising 10% fetal calf serum (FCS) DMEM. After the fourth cycle, the human chondrocytes were maintained in serum-free DMEM for 24 hours, prior to 24 hours of co-treatment with 10 ng/ml IL-1β and various concentrations (5, 10, 20 mM) of Glc, GlcN-S, GlcA and GlcN-HCl. Moreover, the expressions of interested genes (MMP-3, MMP-13, AGG and SOX9) were also investigated for the comparison between fresh primary isolated chondrocyte (P0) and its fourth passages.

Cytotoxic study using the MTT assay

HAC (1 × 10⁴ cells) were plated in triplicate in 96-well-plates and incubated overnight. Cells were treated with different concentrations (5, 10, 20 mM) of Glc, GlcN-S, GlcA and GlcN-HCl for 24 hours. After incubation, culture media were discarded, replaced with new culture media which contained 10% of 5 mg/ml MTT (3,[4,4-dimethy thiazol-2-yl]-2,5-diphenyl-tetrazolium bromide), discarded again, and followed by adding 0.2 ml of dimethyl sulfoxide (DMSO) to each well to solubilize the formed formazane crystals. The absorbance was measured at 540 nm using a microplate reader.

Percent of cell survival was calculated as follows:

 

Measurement of s-GAG concentration

The concentrations of s-GAG in the conditional media were measured using dimethylmethylene blue (DMMB) [18] and a standard of shark cartilage chondroitin sulfate C (Sigma-Aldrich^®, USA). The DMMB solution was used to dilute the sample, the standards and the appropriate blank solution. The absorbance of the resulting solution was measured at 525 nm using a microplate reader spectrophotometer. The levels of the ECM biomolecules released from the cartilage due to induction by IL-1β were calculated as:

 

%change={[(mediumfromD3)−(mediumfromD0)]/(mediumfromD0)}×100

where D0 and D3 are media collected on the start day and the third day, respectively.

Detection of uronic acid

The concentrations of remaining glucuronic acid (GlcUA) in the explants were measured by a colorimetric assay using m-hydroxydiphenyl as a reagent [19]. Explants were digested by papain prior to measurement. The percentage of remaining uronic acid was calculated as:

 

Measurement of HA concentration

HA concentrations were measured using the competitive inhibition-based enzyme-linked immunosorbent assay (ELISA) method using the commercialized AWHA Test kit [20] (Allswell Singapore Pte., Singapore) according to the manufacturer’s instructions.

Gelatin zymography

Pro-MMP-2 in the conditioned medium was detected by gelatin zymography as previously described [21]. The samples were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) using 10% acrylamide gel containing 0.1 mg/ml of gelatin (Sigma-Aldrich^®, USA) at 4°C under non-reducing conditions. After electrophoresis, SDS in the gel was removed by rinsing with 2.5% Triton-X 100 pH 7.5. The gel was then incubated at 37°C in the buffer (50 mM Tris-HCl, 5 mM CaCl₂, 1 μM ZnCl₂, 0.02% NaN₃) for 18 hours and then stained with 0.1% Coomassie brilliant blue R250 (Bio-Rad Laboratories, Hercules, CA) in 50% methanol/10% acetic acid, and destained with 10% acetic acid/50% methanol. Finally, a Scion image densitometer was utilized to analyse the gelatinolytic activity.

Gene expression analysis

RNA was extracted from the monolayer cells using an Aurum total RNA purification kit (Bio-Rad Laboratories, Hercules, CA, USA). Using the RevertAid™ First Stand cDNA synthesis kit (MBI Fermentas, Germany), the net sum RNA (500 ng) of each sample was reverse transcribed into complementary DNA (cDNA). Primer and probe sets were designed using Primer Express 2.0 software (Applied Biosystems, Foster City, CA, USA) and nucleotide sequences are: AGG; 5′ ACTTCCGCTGGTCAGATGGA3′ 3′ CAACACTGCCAACGTCCAGAT5′, SOX9; 5′ ACACACAGCTCACTCGACCTTG 3′, 3′ GGAATTCTGGTTGGTCCTCTCTT 5′, MMP-3; 5′ TTTTGGCCATCTCTTCCTTCA 3′, 3′ TGTGGATGCCTCTTGGG TATC5′, MMP-13; 5′ TCCTCTTCTTGAGCTGGACTCATT 3′, 3′ CGCTCTG CAAACTGGAGGTC 5′, GAPDH; 5′ GAAGGTGAAGGTCGGAGTC3′, 3′ GAAGATGGTGATGGGATTTC 5′. The amplified products were separated by electrophoresis on 2% (w/v) agarose gels, stained with ethidium bromide and then imaged using a Bio-Rad Gel-Doc fluorescent image analyzer. To allow semi-quantitative comparisons of mRNA levels, the integrated densities were calculated by the Scion Image analysis software and divided by levels of the house-keeping gene GAPDH (glyceraldehydes-3-phosphate dehydrogenase) as previously described [22,23].

Statistical analysis

All data were shown as mean ± SD and the statistical analysis was performed using t-tests. P-values less than 0.05 were considered significant.

Results

Chondroprotective effects of Glc, GlcN-S, GlcA and GlcN-HCl in porcine cartilage explants

Porcine cartilage explants were induced to degrade by using 25 ng/ml IL-1β and the chondroprotective effects of all four chemicals were studied by co-treating the explants with IL-1β and each chemical (20, 40, 80 mM) for 3 days. Conditioned media were collected and analyzed. Many molecules were used to be the indicators. Interleukin-1 beta induces the degradation of extracellular matrix (ECM) molecules in cartilage discs, and degraded ECM molecules will be released into the media while undegraded molecules will remain in the cartilage tissue.

The release of HA and s-GAG, which are ECM molecules, from cartilage tissue into media were analyzed by ELISA and dye-binding assays, respectively. Gelatin zymography was used to measure MMP-2 activity. The remnant ECM molecules were measured by digestion of conditioned cartilage with papain, followed by measuring the remaining uronic acid.

IL-1β induced the release of HA and s-GAG from cartilage into media (Figure 1A, B). GlcN-S, GlcN-HCl and GlcA decreased HA release. Among these three chemicals, GlcN-S exhibited the highest inhibitory effect. However, HA released to the media was not reduced by Glc (Figure 1A). For s-GAG releases, GlcN-S and GlcN-HCl had the ability to reduce s-GAG release while Glc and GlcA did not. GlcN-S also had the highest effect on s-GAG. Moreover, IL-1β induced the activity of MMP-2 (Figure 2). This induced activity was decreased by GlcA, GlcN-HCl and GlcN-S, but not by Glc. Similarly to HA and s-GAG, GlcN-S possessed the highest inhibitory effect.

Figure 1. The effects of Glc, GlcN-S, GlcA and GlcN-HCl: release of s-GAG, HA from porcine cartilage tissues to the media, the uronic acid remaining in the cartilage tissue. Porcine cartilage explants were cultured with IL-1β (25 ng/ml) in absence and presence of each chemical (at varying concentrations of 20, 40, 80 mM) for 3 days. In the media, the s-GAG release was measured by using a dye-binding assay, and HA release was measured by ELISA. Cartilage discs were digested with papain and then the uronic acid content was measured. *, ** Denotes: a value that is significantly different (p < 0.05 and p < 0.01, respectively) from the IL-1β control.

Figure 2. Effects of Glc, GlcN-S, GlcA and GlcN-HCl on the production of MMP-2. Porcine cartilage explants were cultured with IL-1β (25 ng/ml) in the absence and presence of each chemical (at varying concentrations of 20, 40, 80 mM) for 3 days. Media were collected and were then analyzed by gelatin zymography as described in the text. Three experiments were carried out independently and they were reproducible. *, ** Denotes a value that is significantly different (p < 0.05 and p < 0.01, respectively) from the IL-1β control.

For the remaining uronic acid in cartilage discs, when the cartilage discs were treated with IL-1β, the remaining uronic acid content was lower than that of the control group (Figure 1C). All four chemicals did not significantly reverse this effect of IL-1β, but GlcN-S and GlcN-HCl tended to inhibit uronic acid loss from cartilage at the highest dosage (80 mM). Altogether, these results suggest that GlcN-S had the highest chondroprotective effect among all four chemicals used in our porcine cartilage explant model. We continued by analyzing the chondroprotective effects of all four chemicals in human chondrocytes.

Cytotoxic effects of Glc, GlcN-S, GlcA and GlcN-HCl in HAC

The cytotoxic effects of 5, 10 and 20 mM of all four chemicals were initially studied in the HAC model. As shown in Figure 3, none of the three concentrations of the four chemicals had cytotoxic effects on HAC. Thus, these three concentrations could be used for studying the chondroprotective effects of the chemicals in subsequent experiments.

Figure 3. The cytotoxic effects of Glc, GlcN-S, GlcA and GlcN-HCl. The cytotoxic effect of all reagents at concentrations 5, 10 and 20 mM in human articular chondrocytes were studied by the MTT assay.

Effects of Glc, GlcN-S, GlcA and GlcN-HCl on HA release and MMP-2 activity in IL-1β-treated-HAC

HACs were co-treated with 10 ng/ml IL-1β and 5, 10 and 20 mM of each chemical for 24 hours. The conditioned media were collected and analyzed for HA and MMP-2 activity.

IL-1β was able to induce the release of HA and MMP-2 activity into the media (Figure 4). The induced released HA was inhibited by GlcN-S, Glc and GlcN-HCl but was not inhibited by GlcA. GlcN-S showed the highest inhibitory effect, followed by Glc and GlcN-HCl (Figure 4A). Glc and GlcA did not decrease induced MMP-2 activity, whereas both GlcN-S and GlcN-HCl did so. Among the four chemicals studied, GlcN-S had the highest inhibitory effect (Figure 4B). In the human chondrocyte model, GlcN-S also had the highest chondroprotective effect.

Figure 4. Effects of Glc, GlcN-S, GlcA and GlcN-HCl on the release of HA (A), s-GAG (B) and MMP-2 (C) from chondrocytes. Chondrocytes were co-treated with 10 ng/ml IL-1β and various concentrations of each chemical (5, 10, 20 mM) for 24 hours. The conditioned media were analyzed for HA, s-GAG and MMP-2 activity as described in the Experimental section. *,** Denotes a value that is significantly different (p<0.05 and p<0.01, respectively) from the IL-1β control.

Effects of Glc, GlcN-S, GlcA and GlcN-HCl on catabolic gene expression in HAC

To study gene expression, HACs were co-treated with 10 ng/ml IL-1β and 5, 10 and 20 mM of each chemical for 24 hours. Cells were harvested and then extracted for mRNA, which was used to synthesize cDNA. The RT-PCR was performed using the primers as described in Methods.

It has been well documented that the expression levels of many genes change in cultured chondrocytes as compared to that in intact cartilage and, moreover, between the cultured passages [24-27]. To avoid the variations of the expression levels between passages, the genes showing negligible change between passage cultures were chosen for further investigation. There was a report found that the expression of MMP-3, MMP-13, aggrecan core protein (AGG) and SOX-9 (a transcriptional factor for type II collagen) were not significantly changed between fresh isolated chondrocytes (passage 2) and used passage (passage 4) [28]. In agreement with previous studies, we found that MMP-3, MMP-13, AGG and SOX9 mRNA expressions in P4 cultured chondrocytes were not significantly different with fresh isolated chondrocytes (Figure 5). Due to there was no variation of these genes between P0 and P4 cultured chondrocytes, thus MMP-3, MMP-13, AGG and SOX9 gene expressions were chosen for further investigation.

Figure 5. The mRNA expression of MMP-3, MMP-13, AGG and SOX9 in fresh isolated chondrocytes (P0) and in the fourth cultured passage chondrocytes (P4). Passage 0 and P4 confluent human chondrocytes in 25-cm³ flasks were cultured in serum free-DMEM for 24 hours. Cells were harvested and gene expression was analyzed. MMP, matrix metalloproteinase, AGG, aggrecan; SOX9, SRY-type HMG box.

Regarding the expression of catabolic genes, we studied MMP-3 and MMP-13. Both MMP-3 and -13 gene expressions were induced by IL-1β (Figure 6). The induced MMP-3 expression was inhibited by GlcN-HCl and GlcN-S, while GlcN-HCl showing the highest inhibitory effect. Glc and GlcA had no inhibitory effect on expression of either gene. On the contrary, Glc and GlcA seemed to further induce MMP-3 expression. For MMP-13, GlcN-HCl and GlcN-S could inhibit the induction of MMP-13 by IL-1β, and GlcN-S showed the highest inhibitory effect. Glc had no effect on induced MMP-13 expression, but GlcA increased MMP-13 expression.

Figure 6. Effect of Glc, GlcN-S, GlcA and GlcN-HCl on the mRNA expression of proteinases [MMP-3 (A), -13 (B)]. Confluent human chondrocytes in 25-cm³ flasks were cultured with IL-1β (10 ng/ml) in the presence and absence of each chemical for 24 hours. Cells were harvested and gene expression was analyzed. MMP, matrix metalloproteinase. *, ** Denotes a value that is significantly different (p < 0.05 and p < 0.01, respectively) from the IL-1β control.

Effects of Glc, GlcN-S, GlcA and GlcN-HCl on anabolic gene expressions in HAC

Regarding the effects of the tested compounds on anabolic genes, we analyzed the expression of AGG and SOX9. There was no significant difference in expression of either AGG or SOX9 genes when treated with IL-1β (Figure 7). Glucose and GlcA induced AGG gene expression, while GlcN-HCl and GlcN-S showed reduced effects. The GlcN-HCl group had the highest effect. SOX9 expression was not changed when treated with Glc or GlcN-S, but was increased by GlcA and was decreased by GlcN-HCl.

Figure 7. Effects of Glc, GlcN-S, GlcA and GlcN-HCl on the mRNA expression of cartilage genes [AGG (A), SOX9 (B)]. Confluent human chondrocytes in 25-cm³ flasks were cultured with IL-1β (10 ng/ml) in the presence and absence of each chemical for 24 hours. Cells were harvested and gene expression was analyzed. AGG, aggrecan; SOX9, SRY-type HMG box. *, ** Denotes a value that is significantly different (p < 0.05 and p < 0.01, respectively) from the IL-1β control.

Discussion

Osteoarthritis (OA) is the most common form of arthritis, affecting millions of people worldwide [29]. It remains the major cause of disability in the elderly, affecting about 60% of men and 70% of women above the age of 65. As regards therapeutic strategies for OA, there are a large number of active research and drug discovery programs aimed to identify structure-modifying ways to inhibit joint destruction in OA, and existing drug therapies to reduce symptoms. None of these approaches, however, has significant efficacy as a disease modifying anti-OA drug [30]. Until recently, COX-2 inhibitors were widely used to provide symptomatic relief, but the increased risk of heart attacks and strokes associated with these drugs led to the recall of some products from the market and warnings concerning their use [31,32]. As alternatives to non-steroidal anti-inflammatory drugs (NSAIDs) and COX-2 inhibitors, other symptom-modifying drugs currently in clinical trials for OA include nitric oxide-releasing analgesics, bradykinin B2 receptor antagonists and capsaisin analogues [33]. Other treatments for OA could include intra-articular injection with long-acting corticosteroids or hyaluronan, which would also provide symptomatic relief. One recent alternative therapy is nutraceutical treatment. Glucosamine (GlcN) is becoming increasingly popular as an alternative treatment for OA. There is evidence that GlcN is equally effective or even better in decreasing pain in patients with knee OA, as compare to low dose NSAID use [3,4]. Furthermore, there are several reports showing that there was less joint space narrowing in people with knee OA who took GlcN compared to placebo, over a period of 3 years [34,35]. This suggests that that GlcN can delay the progression of knee OA. In the last several decades, there has been an increasing number of patients who have started using GlcN, with or without direction from a physician. Although the effectiveness of GlcN has been debated in a recent article, there are clinical studies suggesting that GlcN probably has structure modifying effects in patients with knee OA [34,35]. The underlying effects of GlcN on cartilage that are responsible for these clinical outcomes are still unclear. It has been proposed that addition of GlcN to chondrocyte cell cultures leads to more GAG production, since GlcN is the basic building block of GAG molecules. Some studies have supported this hypothesis [36-40]. However, there are studies that observed negative effects on GAG production after GlcN addition [10,41-45]. Apart from influencing matrix synthesis, several studies have shown that GlcN is also able to interfere with enzymatic matrix degradation [9,46-49]. These conflicting results can have various causes.

It is unclear whether or not GlcN-S, Glc-HCl and N-acetyl-glucosamine (GlcN-Ac) have similar effects on cartilage. Differences in the results can also be explained by the varieties of culture models used (e.g., monolayer or pellet culture) and the variations in culture duration.

No previous studies have examined the metabolism of GlcN in humans. However, there is one published investigation of synovial and plasma GlcN concentrations in OA patients following oral administration of crystalline GlcN-S. That study reported that GlcN is bioavailable both systemically and at the site of action (the joint) [8]. However, it is still unclear whether the administrated GlcN will be metabolized to Glc in humans, and whether metabolized Glc will have effects similar to those of GlcN. Thus, in this experiment, we studied and compared the effects of Glc, GlcA, GlcN-S and GlcN-HCl in two models using IL-1β to induce inflammtion: first in a porcine cartilage explant model, and second, in a human articular chondrocyte (HAC) culture model. In the porcine cartilage explant model, GlcN-S showed the highest chondroprotective effects (inhibited IL-1β’s effect on HA and s-GAG degradation) followed by GlcN-HCl, while Glc and GlcA did not show these effects. In the HAC model, GlcN-S had the highest effect, shown by inhibition of IL-1β induced HA release and MMP-2 activity, followed by GclN-HCl and GlcA, but Glc had no effect. Thus in administration of glucose derivatives, if these reagents were metabolized to Glc, the metabolized compound might not have a chondroprotective effect.

There are also reports showing that GlcN decreases expression of both anabolic and catabolic genes in human OA cartilage explants [12]. We expected that GlcN-S would show the highest inhibitory effect on IL-1β, because it had the highest effect in porcine cartilage explants. But our results showed that only MMP-13 gene expression could be reduced by GlcN-S. For the other catabolic gene, MMP-3 was mostly inhibited by GlcN-HCl, inversely with Glc, and GlcA further induced both MMP-3 and -13 expression in HAC treated with IL-1β. In anabolic gene expression, both AGG and SOX9 gene expression were not significantly changed by IL-1β. AGG expression was induced by Glc and GlcA, but was reduced by GlcN-S and GlcN-HCl. SOX9 expression was increased by GlcA and decreased by GlcN-HCl. Altogether, it seemed that Glc and GlcA could induce both catabolic and anabolic gene expression while GlcN-S and GlcN-HCl reduced the expression of the catabolic genes.

Conclusion

Our results illustrate two key points. Firstly, from the chondroprotective study, GlcN-S had the most significant effect. However, at the mechanistic level of gene expression, GlcN-S had the strongest effect only on MMP-13 expression. Secondly, GlcN-HCl and GlcN-S showed significant effects on catabolic gene expression but not on anabolic genes, whereas Glc and GlcA had significant effects on anabolic genes but not on catabolic genes. However, if we consider chondroprotective effects, GlcN-HCl and GlcN-S were more effective than Glc and GlcA. Here, we used normal HAC and induced inflammation by IL-1β to mimic the onset of OA. These results thus demonstrate the importance of inhibition of catabolic genes in the onset of the disease.

Abbreviations

OA: Osteoarthritis; Glc: Glucose; GlcN: Glucosamine; GlcA: Glucuronic acid; GlcN-HCl: Glucosamine hydrochloride; GlcN-S: Glucosamine sulfate; HA: hyaluronic acid; s-GAG: sulfated glycosaminoglycan; HAC: human articular cartilage; MMP: matrix metalloproteinase

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

TP performed most of the experiments, data analysis and manuscript preparation. PP performed some experiments and participated in the study design and data analysis. PK conceived and developed the study design and participated in manuscript preparation. All authors read and approved the final manuscript.

Acknowledgements

The Royal Golden Jubilee Ph.D. Program (Grant No. PHD/0155/2548 to TP). The Graduate School of Chiang Mai University, Center of Excellence Chiang Mai University Fund and the National Research Council of Thailand provided financial support for this study. We thank Dr. Dale E. Taneyhill for proofreading the manuscript.

References

1. Inerot S, Heinegard D, Audell L, Olsson SE: Articular-cartilage proteoglycans in aging and osteoarthritis.

   Biochem J 1978, 169:143-56. PubMed Abstract | PubMed Central Full Text

2. Setnikar I, Cereda R, Pacini MA, Revel L: Antireactive properties of glucosamine sulfate.

   Arzneimittelforschung 1991, 41:157-61. PubMed Abstract

3. Muller-Fassbender H, Bach GL, Haase W, Rovati LC, Setnikar I: Glucosamine sulfate compared to ibuprofen in osteoarthritis of the knee.

   Osteoarthritis Cartilage 1994, 2:61-9. PubMed Abstract | Publisher Full Text

4. Lopes Vaz A: Double-blind clinical evaluation of the relative efficacy of ibuprofen and glucosamine sulphate in the management of osteoarthrosis of the knee in out-patients.

   Curr Med Res Opin 1982, 8:145-9. PubMed Abstract | Publisher Full Text

5. McAlindon TE, LaValley MP, Gulin JP, Felson DT: Glucosamine and chondroitin for treatment of osteoarthritis: a systematic quality assessment and meta-analysis.

   Jama 2000, 283:1469-75. PubMed Abstract | Publisher Full Text

6. Richy F, Bruyere O, Ethgen O, Cucherat M, Henrotin Y, Reginster JY: Structural and symptomatic efficacy of glucosamine and chondroitin in knee osteoarthritis: a comprehensive meta-analysis.

   Arch Intern Med 2003, 163:1514-22. PubMed Abstract | Publisher Full Text

7. Towheed TE, Maxwell L, Anastassiades TP, Shea B, Houpt J, Robinson V, et al.: Glucosamine therapy for treating osteoarthritis.

   Cochrane Database Syst Rev 2005, CD002946. PubMed Abstract | Publisher Full Text

8. Persiani S, Rotini R, Trisolino G, Rovati LC, Locatelli M, Paganini D, et al.: Synovial and plasma glucosamine concentrations in osteoarthritic patients following oral crystalline glucosamine sulphate at therapeutic dose.

   Osteoarthritis Cartilage 2007, 15:764-72. PubMed Abstract | Publisher Full Text

9. Gouze JN, Bordji K, Gulberti S, Terlain B, Netter P, Magdalou J, et al.: Interleukin-1beta down-regulates the expression of glucuronosyltransferase I, a key enzyme priming glycosaminoglycan biosynthesis: influence of glucosamine on interleukin-1beta-mediated effects in rat chondrocytes.

   Arthritis Rheum 2001, 44:351-60. PubMed Abstract | Publisher Full Text

10. Gouze JN, Bianchi A, Becuwe P, Dauca M, Netter P, Magdalou J, et al.: Glucosamine modulates IL-1-induced activation of rat chondrocytes at a receptor level, and by inhibiting the NF-kappa B pathway.

    FEBS Lett 2002, 510:166-70. PubMed Abstract | Publisher Full Text

11. Largo R, Alvarez-Soria MA, Diez-Ortego I, Calvo E, Sanchez-Pernaute O, Egido J, et al.: Glucosamine inhibits IL-1beta-induced NFkappaB activation in human osteoarthritic chondrocytes.

    Osteoarthritis Cartilage 2003, 11:290-8. PubMed Abstract | Publisher Full Text

12. Uitterlinden EJ, Jahr H, Koevoet JL, Jenniskens YM, Bierma-Zeinstra SM, Degroot J, et al.: Glucosamine decreases expression of anabolic and catabolic genes in human osteoarthritic cartilage explants.

    Osteoarthritis Cartilage 2006, 14:250-7. PubMed Abstract | Publisher Full Text

13. Setnikar I, Palumbo R, Canali S, Zanolo G: Pharmacokinetics of glucosamine in man.

    Arzneimittelforschung 1993, 43:1109-13. PubMed Abstract

14. Abramson SB, Attur M: Developments in the scientific understanding of osteoarthritis.

    Arthritis Res Ther 2009, 11:227. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text

15. Pearson W, Orth MW, Karrow NA, Lindinger MI: Effects of simulated digests of Biota orientalis and a dietary nutraceutical on interleukin-1-induced inflammatory responses in cartilage explants.

    Am J Vet Res 2008, 69:1560-8. PubMed Abstract | Publisher Full Text

16. Pearson W, Orth MW, Karrow NA, Maclusky NJ, Lindinger MI: Anti-inflammatory and chondroprotective effects of nutraceuticals from Sasha’s Blend in a cartilage explant model of inflammation.

    Mol Nutr Food Res 2007, 51:1020-30. PubMed Abstract | Publisher Full Text

17. Phitak T, Choocheep K, Pothacharoen P, Pompimon W, Premanode B, Kongtawelert P: The effects of p-hydroxycinnamaldehyde from Alpinia galanga extracts on human chondrocytes.

    Phytochemistry 2009, 70:237-43. PubMed Abstract | Publisher Full Text

18. Farndale RW, Buttle DJ, Barrett AJ: Improved quantitation and discrimination of sulphated glycosaminoglycans by use of dimethylmethylene blue.

    Biochim Biophys Acta 1986, 883:173-7. PubMed Abstract | Publisher Full Text

19. Blumenkrantz N, Asboe-Hansen G: New method for quantitative determination of uronic acids.

    Anal Biochem 1973, 54:484-9. PubMed Abstract | Publisher Full Text

20. Kongtawelert P, Ghosh P: A method for the quantitation of hyaluronan (hyaluronic acid) in biological fluids using a labeled avidin-biotin technique.

    Anal Biochem 1990, 185:313-8. PubMed Abstract | Publisher Full Text

21. Ito A, Nose T, Takahashi S, Mori Y: Cyclooxygenase inhibitors augment the production of pro-matrix metalloproteinase 9 (progelatinase B) in rabbit articular chondrocytes.

    FEBS Lett 1995, 360:75-9. PubMed Abstract | Publisher Full Text

22. Marchuk L, Sciore P, Reno C, Frank CB, Hart DA: Postmortem stability of total RNA isolated from rabbit ligament, tendon and cartilage.

    Biochim Biophys Acta 1998, 1379:171-7. PubMed Abstract | Publisher Full Text

23. Boykiw R, Sciore P, Reno C, Marchuk L, Frank CB, Hart DA: Altered levels of extracellular matrix molecule mRNA in healing rabbit ligaments.

    Matrix Biol 1998, 17:371-8. PubMed Abstract | Publisher Full Text

24. Benya PD, Padilla SR, Nimni ME: Independent regulation of collagen types by chondrocytes during the loss of differentiated function in culture.

    Cell 1978, 15:1313-21. PubMed Abstract | Publisher Full Text

25. Benya PD, Shaffer JD: Dedifferentiated chondrocytes reexpress the differentiated collagen phenotype when cultured in agarose gels.

    Cell 1982, 30:215-24. PubMed Abstract | Publisher Full Text

26. Huch K, Stove J, Puhl W, Gunther KP: [Review and comparison of culture-techniques for articular chondrocytes].

    Z Orthop Ihre Grenzgeb 2002, 140:145-52. PubMed Abstract | Publisher Full Text

27. Stokes DG, Liu G, Dharmavaram R, Hawkins D, Piera-Velazquez S, Jimenez SA: Regulation of type-II collagen gene expression during human chondrocyte de-differentiation and recovery of chondrocyte-specific phenotype in culture involves Sry-type high-mobility-group box (SOX) transcription factors.

    Biochem J 2001, 360:461-70. PubMed Abstract | Publisher Full Text | PubMed Central Full Text

28. Lin Z, Fitzgerald JB, Xu J, Willers C, Wood D, Grodzinsky AJ, et al.: Gene expression profiles of human chondrocytes during passaged monolayer cultivation.

    J Orthop Res 2008, 26:1230-7. PubMed Abstract | Publisher Full Text

29. Harris ED Jr: The bone and joint decade: a catalyst for progress.

    Arthritis Rheum 2001, 44:1969-70. PubMed Abstract | Publisher Full Text

30. Brandt KD, Mazzuca SA: Lessons learned from nine clinical trials of disease-modifying osteoarthritis drugs.

    Arthritis Rheum 2005, 52:3349-59. PubMed Abstract | Publisher Full Text

31. Solomon SD, McMurray JJ, Pfeffer MA, Wittes J, Fowler R, Finn P, et al.: Cardiovascular risk associated with celecoxib in a clinical trial for colorectal adenoma prevention.

    N Engl J Med 2005, 352:1071-80. PubMed Abstract | Publisher Full Text

32. Solomon DH: Selective cyclooxygenase 2 inhibitors and cardiovascular events.

    Arthritis Rheum 2005, 52:1968-78. PubMed Abstract | Publisher Full Text

33. Wieland HA, Michaelis M, Kirschbaum BJ, Rudolphi KA: Osteoarthritis – an untreatable disease?

    Nat Rev Drug Discov 2005, 4:331-44. PubMed Abstract | Publisher Full Text

34. Pavelka K, Gatterova J, Olejarova M, Machacek S, Giacovelli G, Rovati LC: Glucosamine sulfate use and delay of progression of knee osteoarthritis: a 3-year, randomized, placebo-controlled, double-blind study.

    Arch Intern Med 2002, 162:2113-23. PubMed Abstract | Publisher Full Text

35. Reginster JY, Deroisy R, Rovati LC, Lee RL, Lejeune E, Bruyere O, et al.: Long-term effects of glucosamine sulphate on osteoarthritis progression: a randomised, placebo-controlled clinical trial.

    Lancet 2001, 357:251-6. PubMed Abstract | Publisher Full Text

36. Bassleer C, Henrotin Y, Franchimont P: In-vitro evaluation of drugs proposed as chondroprotective agents.

    Int J Tissue React 1992, 14:231-41. PubMed Abstract

37. Bassleer C, Rovati L, Franchimont P: Stimulation of proteoglycan production by glucosamine sulfate in chondrocytes isolated from human osteoarthritic articular cartilage in vitro.

    Osteoarthritis Cartilage 1998, 6:427-34. PubMed Abstract | Publisher Full Text

38. Dodge GR, Jimenez SA: Glucosamine sulfate modulates the levels of aggrecan and matrix metalloproteinase-3 synthesized by cultured human osteoarthritis articular chondrocytes.

    Osteoarthritis Cartilage 2003, 11:424-32. PubMed Abstract | Publisher Full Text

39. Lippiello L: Glucosamine and chondroitin sulfate: biological response modifiers of chondrocytes under simulated conditions of joint stress.

    Osteoarthritis Cartilage 2003, 11:335-42. PubMed Abstract | Publisher Full Text

40. Vidal y Plana RR, Bizzarri D, Rovati AL: Articular cartilage pharmacology: I. In vitro studies on glucosamine and non steroidal antiinflammatory drugs.

    Pharmacol Res Commun 1978, 10:557-69. PubMed Abstract | Publisher Full Text

41. Anderson CC, Cook JL, Kreeger JM, Tomlinson JL, Wagner-Mann CC: In vitro effects of glucosamine and acetylsalicylate on canine chondrocytes in three-dimensional culture.

    Am J Vet Res 1999, 60:1546-51. PubMed Abstract

42. de Mattei M, Pellati A, Pasello M, de Terlizzi F, Massari L, Gemmati D, et al.: High doses of glucosamine-HCl have detrimental effects on bovine articular cartilage explants cultured in vitro.

    Osteoarthritis Cartilage 2002, 10:816-25. PubMed Abstract | Publisher Full Text

43. Fenton JI, Chlebek-Brown KA, Peters TL, Caron JP, Orth MW: The effects of glucosamine derivatives on equine articular cartilage degradation in explant culture.

    Osteoarthritis Cartilage 2000, 8:444-51. PubMed Abstract | Publisher Full Text

44. Ilic MZ, Martinac B, Handley CJ: Effects of long-term exposure to glucosamine and mannosamine on aggrecan degradation in articular cartilage.

    Osteoarthritis Cartilage 2003, 11:613-22. PubMed Abstract | Publisher Full Text

45. Orth MW, Peters TL, Hawkins JN: Inhibition of articular cartilage degradation by glucosamine-HCl and chondroitin sulphate.

    Equine Vet J Suppl 2002, 224-9. PubMed Abstract

46. Byron CR, Orth MW, Venta PJ, Lloyd JW, Caron JP: Influence of glucosamine on matrix metalloproteinase expression and activity in lipopolysaccharide-stimulated equine chondrocytes.

    Am J Vet Res 2003, 64:666-71. PubMed Abstract | Publisher Full Text

47. Mello DM, Nielsen BD, Peters TL, Caron JP, Orth MW: Comparison of inhibitory effects of glucosamine and mannosamine on bovine articular cartilage degradation in vitro.

    Am J Vet Res 2004, 65:1440-5. PubMed Abstract | Publisher Full Text

48. Piperno M, Reboul P, Hellio Le Graverand MP, Peschard MJ, Annefeld M, Richard M, et al.: Glucosamine sulfate modulates dysregulated activities of human osteoarthritic chondrocytes in vitro.

    Osteoarthritis Cartilage 2000, 8:207-12. PubMed Abstract | Publisher Full Text

49. Sandy JD, Gamett D, Thompson V, Verscharen C: Chondrocyte-mediated catabolism of aggrecan: aggrecanase-dependent cleavage induced by interleukin-1 or retinoic acid can be inhibited by glucosamine.

    Biochem J 1998, 335(Pt 1):59-66. PubMed Abstract | Publisher Full Text | PubMed Central Full Text

Pre-publication history

The pre-publication history for this paper can be accessed here:

http://www.biomedcentral.com/1471-2474/11/162/prepub

1. M. Viuda-Martos,
2. J. Fernández-López,
3. J.A. Pérez-Álvarez

Article first published online: 22 OCT 2010

DOI: 10.1111/j.1541-4337.2010.00131.x

© 2010 Institute of Food Technologists^®

Issue

• Adams LS, Seeram NP, Aggarwal BB, Takada Y, Sand D, Heber D. 2006. Pomegranate juice, total pomegranate ellagitannins and punicalagin suppress inflammatory cell signalling in colon cancer cells. J Agric Food Chem 54:980–5.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 60
• Afaq F, Saleem M, Krueger CG, Reed JD, Mukhtar H. 2005. Anthocyanin and hydrolyzable tannin-rich pomegranate fruit extract modulates MAPK and NF-kappa B pathways and inhibits skin tumorigenesis in CD-1 mice. Int J Cancer 113:423–33.
  Direct Link:

  • Abstract
  • Full Article (HTML)
  • PDF(2945K)
  • References
  • Web of Science® Times Cited: 87
• Afaq F, Zaid MA, Khan N, Dreher M, Mukhtar H. 2009. Protective effect of pomegranate-derived products on UVB-mediated damage in human reconstituted skin. Exp Dermatol 18(6):553–61.
  Direct Link:

  • Abstract
  • Full Article (HTML)
  • PDF(551K)
  • References
  • Web of Science®
• Ahmad I, Beg AZ. 2001. Antimicrobial and phytochemical studies on 45 Indian medicinal plants against multi-drug and resistant human pathogens. J Ethnopharmacol 74:113–23.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 72
• Ahmed S, Wang N, Hafeez BB, Cheruvu VK, Haqii TM. 2005. Punica granatum L. extract inhibits IL-1 beta-induced expression of matrix metalloproteinases by inhibiting the activation of MAP kinases and NF-kappaB in human chondrocytes in vitro. J Nutr 135:2098–102.
• Albrecht M, Jiang W, Kumi-Diaka J, Lansky EP, Gommersall LM, Patel A, Mansel RE, Neeman I, Geldof AA, Campbell MJ. 2004. Pomegranate extracts potently suppress proliferation, xenograft growth, and invasion of human prostate cancer cells. J Med Food 7(3):274–83.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 45
• Alper N, Acar J. 2004. Removal of phenolic compounds in pomegranate juices using ultrafiltration and laccase-ultrafiltration combinations. Die Nahrung 48(3):184–7.
  Direct Link:

  • Abstract
  • PDF(216K)
  • References
  • Web of Science® Times Cited: 5
• Althunibat OY, Al-Mustafa AH, Tarawneh K, Khleifat KM, Ridzwan BH, Qaralleh HN. 2010. Protective role of Punica granatum L. peel extract against oxidative damage in experimental diabetic rats. Process Biochem 45(4):581–5.
  • CrossRef,
  • CAS,
  • Web of Science®
• Alzamora SM, Salvatori D, Tapia SM, López-Malo A, Welti-Chanes J, Fito P. 2005. Novel functional foods from vegetable matrices impregnated with biologically active compounds. J Food Eng 67:205–14.
  • CrossRef,
  • Web of Science® Times Cited: 17
• Al-Zoreky NS. 2009. Antimicrobial activity of pomegranate (Punica granatum L.) fruit peels. Int J Food Microbiol 134:244–8.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 1
• Amakura Y, Okada M, Tsuji S, Tonogai Y. 2000. High-performance liquid chromatographic determination with photodiode array detection of ellagic acid in fresh and processed fruits. J Chromatog A 896:87–93.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 40
• Amarowicz R, Pegg RB, Rahimi-Moghaddam P, Barl B, Weil JA. 2004. Free-radical scavenging capacity and antioxidant activity of selected plant species from the Canadian prairies. Food Chem 84:551–62.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 141
• Aslam MN, Lansky EP, Varani J. 2006. Pomegranate as a cosmeceutical source: Pomegranate fractions promote proliferation and procollagen synthesis and inhibit matrix metalloproteinase-1 production in human skin cells. J Ethnopharmacol 103:311–8.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 16
• Aviram M, Dornfeld L. 2001. Pomegranate juice consumption inhibits serum angiotensin-converting enzyme activity and reduces systolic blood pressure. Atherosclerosis 158(1):195–8.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 77
• Aviram M, Dornfeld L, Rosenblat M, Volkova N, Kaplan M, Coleman R, Hayek T, Presser D, Fuhrman B. 2000. Pomegranate juice consumption reduces oxidative stress, atherogenic modifications to LDL, and platelet aggregation: studies in humans and in atherosclerotic apolipoprotein E-deficient mice. Am J Clinl Nutr 71:1062–76.
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 223
• Aviram M, Rosenblat M, Gaitini D, Nitecki S, Hoffman A, Dornfeld L, Volkova N, Presser D, Attias J, Liker H, Hayek T. 2004. Pomegranate juice consumption for 3 years by patients with carotid artery stenosis reduces common carotid intima-media thickness, blood pressure and LDL oxidation. Clin Nutr 23(3):423–33.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 104
• Aviram M, Volkova N, Coleman R, Dreher M, Reddy MK, Ferreira D, Rosenblat M. 2008. Pomegranate phenolics from the peels, arils, and flowers are antiatherogenic: studies in vivo in atherosclerotic apolipoprotein E-deficient (E0) mice and in vitro in cultured macrophages and lipoproteins. J Agric Food Chem 56:1148–57.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 23
• Azadzoi KM, Schulman RN, Aviram M, Siroky MB. 2005. Oxidative stress in arteriogenic erectile dysfunction: prophylactic role of antioxidants. J Urol 174(1):386–93.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 28
• Badria FA, Zidan OA. 2004. Natural products for dental caries prevention. J Med Food 7:381–4.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 6
• Bagri P, Ali M, Aeri V, Bhowmik M, Sultana S. 2009. Antidiabetic effect of Punica granatum flowers: effect on hyperlipidemia, pancreatic cells, lipid peroxidation and antioxidant enzymes in experimental diabetes. Food Chem Toxicol 47:50–4.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 2
• Balasundram N, Sundram K, Samman S. 2006. Phenolic compounds in plants and agri-industrial by-products: antioxidant activity, occurrence, and potential uses. Food Chem 99:191–203.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 112
• Barzegar M, Fadavi A, Azizi MH. 2004. An investigation on the physico-chemical composition of various pomegranates (Punica granatum L.) grown in Yazd. Iranian J Food Sci Technol 2:9–14.
• Basu A, Penugonda K. 2009. Pomegranate juice: a heart-healthy fruit juice. Nutr Rev 67(1):49–56.
  Direct Link:

  • Abstract
  • Full Article (HTML)
  • PDF(489K)
  • References
  • Web of Science® Times Cited: 4
• Belal SKM, Abdel-Rahman AH, Mohamed DS, Osman HEH, Hassan NA. 2009. Protective effect of pomegranate fruit juice against Aeromonas hydrophila-induced intestinal histopathological changes in mice. World Appl Sci J 7(2):245–54.
  • CAS
• Bialonska D, Kasimsetty SG, Schrader KK, Ferreira D. 2009. The effect of pomegranate (Punica granatum L.) byproducts and ellagitannins on the growth of human gut bacteria. J Agric Food Chem 57:8344–9.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 1
• Bielli P, Calabrese L. 2002. Structure to function relationships in ceruloplasmin: a ‘moonlighting’ protein. Cell Mol Life Sci 59:1413–27.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 57
• Borochov-Neori H, Judeinstein S, Tripler S, Harari M, Greenberg A, Shomer I, Holland D. 2009. Seasonal and cultivar variations in antioxidant and sensory quality of pomegranate (Punica granatum L.) fruit. J Food Comp Anal 22(3):189–95.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 3
• Boussetta T, Raad H, Lettéron P, Gougerot-Pocidalo MA, Marie JC, Driss F, El-Benna J. 2009. Punicic acid, a conjugated linolenic acid, inhibits TNFα-induced neutrophil hyperactivation and protects from experimental colon inflammation in rats. PLoS One 4(7):6458. Available from: http://www.plosone.org .
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 2,
  • ADS
• Braga LC, Shupp JW, Cummings C, Jett M, Takahaski JA, Carmo LS, Chartone-Souza E, Nascimento AMA. 2005a. Pomegranate extract inhibits Staphylococcus aureus growth and subsequent enterotoxin production. J Ethnopharmacol 96:335–9.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 15
• Braga LC, Leite AA, Xavier KG, Takahashi JA, Bemquerer MP, Chartone-Souza E, Nascimento AM. 2005b. Synergistic interaction between pomegrante extract and antibiotics against Staphylococcus aureus. Can J Microbiol 51:541–7.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 24
• Çam M, Hısıl Y, Durmaz G. 2009. Classification of eight pomegranate juices based on antioxidant capacity measured by four methods. Food Chem 112:721–6.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 4
• Celik I, Temur A, Isik I. 2009. Hepatoprotective role and antioxidant capacity of pomegranate (Punica granatum) flowers infusion against trichloroacetic acid-exposed rats. Food Chem Toxicol 47(1):145–9.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 2
• Cerdá B, Ceron JJ, Tomas-Barberan FA, Espin JC. 2003. Repeated oral administration of high doses of pomegranate ellagitannin punicalagin to rats for 37 days is not toxic. J Agric Food Chem 51:3493–501.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 50
• Cerdá B, Espin JC, Parra S, Martinez P, Tomas-Barberan FA. 2004. The potent in vitro antioxidant ellagitannins from pomegranate juice are metabolized into bioavailable but poor antioxidant hydroxy-6H-dibenzopyran-6-one derivatives by the colonic microflora of healthy humans. Eur J Nutr 43:205–20.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 56
• Cheng JT, Liu IM. 2000. Stimulatory effect of caffeic acid on alpha1A-adrenoceptors to increase glucose uptake into cultured C2C12 cells. Naunyn Schmiedebergs Arch Pharmacol 362:122–7.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 25
• Cho H, Yun CW, Park WK, Kong JY, Kim KS, Park Y, Lee S, Kim BK. 2004. Modulation of the activity of pro-inflammatory enzymes, COX-2 and iNOS, by chrysin derivatives. Pharcacol Res 49:37–43.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 28
• Choi JG, Kang OH, Lee YS, Chae HS, Oh YC, Brice OO, Kim MS, Sohn DH, Kim HS, Park H, Shin DW, Rho JR, Kwon DY. 2009. In vitro and in vivo antibacterial activity of Punica granatum peels ethanol extract against salmonella. Evid Based Compl Alter Med 17:1–8.
• Chung KT, Lu Z, Chou MW. 1998. Mechanism of inhibition of tannic acid and related compounds on the growth of intestinal bacteria. Food Chem Toxicol 36:1053–60.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 49
• Clifford MN, Scalbert A. 2000. Review: ellagitannins—nature, occurrence and dietary burden. J Sci Food Agric 80:1118–25.
  Direct Link:

  • Abstract
  • Full Article (HTML)
  • PDF(129K)
  • References
  • Web of Science® Times Cited: 99
• Cristani M, D’Arrigo M, Mandalari G, Castelli F, Sarpietro MG, Micieli D, Venuti V, Bisignano G, Saija A, Trombetta D. 2007. Interaction of four monoterpenes contained in essential oils with model membranes: implications for their antibacterial activity. J Agric Food Chem 55(15):6300–8.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 17
• Daker M, Abdullah N, Vikineswary S, Goh PC, Kuppusamy UR. 2008. Antioxidant from maize and maize fermented by Marasmiellus sp. as stabiliser of lipid-rich foods. Food Chem 107:1092–8.
  • CAS,
  • Web of Science® Times Cited: 10
• Dao TT, Chi YS, Kim J, Kim HP, Kimb S, Parka H. 2004. Synthesis and inhibitory activity against COX-2 catalyzed prostaglandin production of chrysin derivatives. Bioorg Med Chem Lett 14:1165–7.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 28
• Das AK, Mandal SC, Banerjee SK, Sinha S, Saha BP, Pal M. 2001. Studies on the hypoglycaemic activity of Punica granatum seed in streptozotocin induced diabetic rats. Phytother Res 15(7):628–9.
  Direct Link:

  • Abstract
  • PDF(53K)
  • References
  • Web of Science® Times Cited: 10
• Davidson PM. 2001. Chemical preservatives and natural antimicrobial compounds. In: DoyleMP, BeuchatLR, MontvilleTJ, editors. Food microbiology: fundamentals and frontiers. 2nd ed. Washington , D.C. : ASM Press. p 593–627.
  • Web of Science® Times Cited: 10
• Davidson MH, Maki KC, Dicklin MR, Feinstein SB, Witchger MS, Bell M, McGuire DK, Provos JC, Liker H, Aviram M. 2009. Effects of consumption of pomegranate juice on carotid intima-media thickness in men and women at moderate risk for coronary heart disease. Ame J Cardiol 104(7):936–42.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 2
• De Nigris F, Williams-Ignarro S, Botti C, Sica V, Ignarro LJ, Napoli C. 2006. Pomegranate juice reduces oxidized low-density lipoprotein downregulation of endothelial nitric oxide synthase in human coronary endothelial cells. Nitric Oxide 15(3):259–63.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 5
• De Nigris F, Balestrieri ML, Williams-Ignarro S, D’Armiento FP, Fiorito C, Ignarro LJ, Napoli C. 2007. The influence of pomegranate fruit extract in comparison to regular pomegranate juice and seed oil on nitric oxide and arterial function in obese Zucker rats. Nitric Oxide 17:50–4.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 10
• De Siqueira RS, Dodd CE, Rees CE. 2006. Evaluation of the natural viricidal activity of teas for use in the phage amplification assay. Int J Food Microbiol 111(3):259–62.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 4
• Devipriya N, Sudheer AR, Vishwanathan P, Menon VP. 2008. Modulatory potential of ellagic acid, a natural plant polyphenol on altered lipid profile and lipid peroxidation status during alcohol-induced toxicity: A pathohistological study. J Biochem Mol Toxicol 22(2):101–12.
  Direct Link:

  • Abstract
  • PDF(519K)
  • References
  • Web of Science® Times Cited: 1
• Di Silvestro RA, Di Silvestro DJ, Di Silvestro DJ. 2009. Pomegranate extract mouth rinsing effects on saliva measures relevant to gingivitis risk. Phytother Res 23:1123–7.
  Direct Link:

  • Abstract
  • PDF(116K)
  • References
  • Web of Science® Times Cited: 1
• Duman AD, Ozgen M, Dayisoylu KS, Erbil N, Durgac C. 2009. Antimicrobial activity of six pomegranate (Punica granatum L.) varieties and their relation to some of their pomological and phytonutrient characteristics. Molecules 14:1808–17.
  • CrossRef,
  • PubMed,
  • Web of Science® Times Cited: 1
• [EC] European Commission. 1999. European Commission concerted action on functional food science in Europe: Scientific concepts of functional foods in Europe. Consensus document. Br J Nutr 81(1):1–27.
• El-Nemr SE, Ismail IA, Ragab M. 2006. Chemical composition of juice and seeds of pomegranate fruit. Die Nahrung 34(7):601–6.
  Direct Link:

  • Abstract
  • PDF(331K)
  • References
• Ercisli S, Agar G, Orhan E, Yildirim N, Hizarci Y. 2007. Interspecific variability of RAPD and fatty acid composition of some pomegranate cultivars (Punica granatum L.) growing in southern Anatolia region in Turkey. Biochem Syst Ecolo 35(11):764–9.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 13
• Esmaillzadeh A, Azadbakht L. 2008. Food intake patterns may explain the high prevalence of cardiovascular risk factors among Iranian women. J Nutr 138(8):1469–75.
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 5
• Esmaillzadeh A, Tahbaz F, Gaieni I, Alavi-Majd H, Azadbakht L. 2004. Concentrated pomegranate juice improves lipid profiles in diabetic patients with hyperlipidemia. J Medic Food 7:305–8.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 12
• Esmaillzadeh A, Tahbaz F, Gaieni I, Alavi-Majd H, Azadbakht L. 2006. Cholesterol-lowering effect of concentrated pomegranate juice consumption in type II diabetic patients with hyperlipidemia. Int J Vitam Nutr Res 76:147–51.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 5
• Fadavi A, Barzegar M, Azizi MH, Bayat M. 2005. Physicochemical composition of ten pomegranate cultivars (Punica granatum L.) grown in Iran. Food Sci Technol Int 11:113–9.
  • CrossRef,
  • Web of Science® Times Cited: 10
• Fadavi A, Barzegar M, Azizi HM. 2006. Determination of fatty acids and total lipid content in oilseed of 25 pomegranates varieties grown in Iran. J Food Comp Anal 19:676–80.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 15
• Fan J, Watanabe T. 2003. Inflammatory reactions in the pathogenesis of atherosclerosis. J Atheroscler Thromb 10:63–71.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 10
• Faria A, Monteiro R, Mateus N, Azevedo S, Calhau C. 2007. Effect of pomegranate (Punica granatum) juice intake on hepatic oxidative stress. Eur J Nutr 46(5):271–8.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 11
• Feng W, Zheng X. 2007. Essential oils to control Alternaria alternata in vitro and in vivo. Food Cont 18:1126–30.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 14
• Fernández-López J, Viuda-Martos M, Sendra E, Sayas-Barberá E, Navarro C, Pérez-Alvarez JA. 2007. Orange fibre as potential functional ingredient for dry-cured sausages. Eur Food Res Technol 226(1–2):1–6.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 13
• Fjaeraa C, Nanberg E. 2009. Effect of ellagic acid on proliferation, cell adhesion and apoptosis in SH-SY5Y human neuroblastoma cells. Biomed Pharmacother 63:254–61.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 5
• Forest CP, Padma-Nathan H, Liker HR. 2007. Efficacy and safety of pomegranate juice on improvement of erectile dysfunction in male patients with mild to moderate erectile dysfunction: a randomized, placebo-controlled, double-blind crossover study. Int J Impot Res 19(6):564–7.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 3
• Fuhrman B, Volkova N, Aviran M. 2005. Pomegranate juice oxidized LDL uptake and cholesterol biosynthesis in macrophages. J Nutr Biochem 16:570–6.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 19
• Fuhrman B, Volkova N, Aviran M. 2010. Pomegranate juice polyphenols increase recombinant paraoxonase-1 binding to high-density lipoprotein: studies in vitro and in diabetic patients. Nutr 26(4):359–66.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 1
• Galaverna G, Di Silvestro G, Cassano A, Sforza S, Docena A, Drioli E, Marchelli R. 2008. A new integrated membrane process for the production of concentrated blood orange juice: effect on bioactive compounds and antioxidant activity. Food Chem 106:1021–30.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 6
• García-Segovia P, Andres-Bello A, Martinez-Monzo J. 2007. Effect of cooking method on mechanical properties, color and structure of beef muscle (M. pectoralis). J Food Eng 80:813–21.
  • CrossRef,
  • Web of Science® Times Cited: 12
• Gil MI, Tomas-Barberan FA, Hess-Pierce B, Holcroft DM, Kader AA. 2000. Antioxidant activity of pomegranate juice and its relationship with phenolic composition and processing. J Agric Food Chem 48:4581–9.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 308
• Goel G, Puniya AK, Aguilar CN, Singh K. 2005. Interaction of gut microflora with tannins in feeds. Naturwissenschaften 92:497–503.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 14,
  • ADS
• González-Sarrías A, Espín JC, Tomás-Barberán FA, García-Conesa MT. 2009. Gene expression, cell cycle arrest and MAPK signaling regulation in Caco-2 cells exposed to ellagic acid and its metabolites, urolithins. Mol Nutr Food Res 53(6):686–98.
  Direct Link:

  • Abstract
  • PDF(1011K)
  • References
  • Web of Science® Times Cited: 5
• Gordon MF. 1990. The mechanism of antioxidant action in vitro. In: HudsonBJF, editor. Food antioxidants. London : Elsevier Applied Science. p 1–18.
  • CrossRef
• Gould SWJ, Fielder MD, Kelly AF, Naughton DP. 2009. Anti-microbial activities of pomegranate rind extracts: enhancement by cupric sulphate against clinical isolates of S. aureus, MRSA and PVL positive CA-MSSA. BMC Comple Alter Med 9:23.
  • CrossRef,
  • CAS,
  • Web of Science®
• Guo C, Wei J, Yang JJ, Xu J, Pang W, Jiang YG. 2008. Pomegranate juice is potentially better than apple juice in improving antioxidant function in elderly subjects. Nutr Res 28:72–7.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 6
• Haidari M, Ali M, Casscells SW, Madjid M. 2009. Pomegranate (Punica granatum) purified polyphenol extract inhibits influenza virus and has a synergistic effect with oseltamivir. Phytomed. DOI: 10.1016/j.phymed.2009.06.002 .
  • CrossRef,
  • Web of Science® Times Cited: 3
• Hajimahmoodi M, Oveisi MR, Sadeghi N, Jannat B, Hajibabi M, Farahani E, Akrami MR, Namdar R. 2008. Antioxidant properties of peel and pulp hydro extract in ten Persian pomegranate cultivars. Pak J Biol Sci 11:1600–4.
  • CrossRef,
  • PubMed,
  • CAS
• Hajimahmoodi M, Oveisi MR, Sadeghi N, Jannat B, Nateghi M. 2009. Antioxidant capacity of plasma after pomegranate intake in human volunteers. Acta Med Iran 47(2):125–32.
  • CAS
• Halliwell B, Zhao K, Whiteman ML. 2000. The gastrointestinal tract: a major site of antioxidant action? Free Rad Res 33:819–30.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 147
• Hamad AW, Al-Momene W. 2009. Separation and purification of crude ellagic acid from white flesh of pomegranate fruits as a potent anti-carcinogenic. New Biotechnol 25(1):286.
  • CrossRef,
  • Web of Science®
• Heber D, Seeram NP, Wyatt H, Henning SM, Zhang Y, Ogden LG, Dreher M, Hill JO. 2007. Safety and antioxidant activity of a pomegranate ellagitannin-enriched polyphenol dietary supplement in overweight individuals with increased waist size. J Agric Food Chem 55(24):10050–4.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 16
• Heinecke JW. 1998. Oxidants and antioxidants in the pathogenesis of atherosclerosis: implications for the oxidized low density lipoprotein hypothesis. Atherosclerosis 141:1–15.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 274
• Heinecke JW. 2006. Lipoprotein oxidation in cardiovascular disease: chief culprit or innocent bystander? J Exp Med 203(4):813–6.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 19
• Hong MY, Seeram NP, Heber D. 2008. Pomegranate polyphenols down-regulate expression of androgen-synthesizing genes in human prostate cancer cells over-expressing the androgen receptor. J Nut Biochem 19:848–55.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 4
• Hossin FLA. 2009. Effect of pomegranate (Punica granatum) peels and its extract on obese hypercholesterolemic rats. Pak J Nutr 8(8):1251–7.
  • CrossRef
• Hsu FL, Chen YC, Cheng JT. 2000. Caffeic acid as active principle from the fruit of Xanthium strumarium to lower plasma glucose in diabetic rats. Planta Med 66:228–30.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 45
• Huang THW, Peng G, Kota BP, Li GQ, Yamahara J, Roufogalis BD, Li Y. 2005. Anti-diabetic action of Punica granatum flower extract: activation of PPAR-g and identification of an active component. Toxicol App Pharmacol 207:160–9.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 35
• Huang THW, Peng G, Kota BP, Li GQ, Yamahara J, Roufogalis BD, Li Y. 2009. Pomegranate flower improves cardiac lipid metabolism in a diabetic rat model: role of lowering circulating lipids. Brit J Pharmacol 45(6):767–74.
• [IFIC] International Food Information Council. 2009. Functional foods: attitudinal research. International Food Information Council web site. Available from: http://www.ific.org/research/funcfoodsres02.cfm . Accessed Oct 2009.
• [IFT] Institute of Food Technologists. 2009. Functional foods: opportunities and challenges. Institute of Food Technologists web site. Available from: http://members.ift.org/IFT/Research/IFTExpertReports/functionalfoods_report.htm . Accessed Oct 2009.
• Ignarro LJ, Byrns RE, Sumi D, De Nigris F, Napoli C. 2006. Pomegranate juice protects nitric oxide against oxidative destruction and enhances the biological actions of nitric oxide. Nitric Oxide 15:93–102.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 19
• Jafri MA, Aslam M, Javed K, Singh S. 2000. Effect of Punica granatum Linn. (flowers) on blood glucose level in normal and alloxan-induced diabetic rats. J Ethnopharmacol 70(3):309–14.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 23
• Jahfar M, Vijayan KK, Azadi P. 2003. Studies on a polysaccharide from the fruit rind of Punica granatum. Res J Chem Environ 7:43–50.
  • CAS
• Jaiswal V, DerMarderosian A, Porter JR. 2010. Anthocyanins and polyphenol oxidase from dried arils of pomegranate (Punica granatum L.). Food Chem 118:11–6.
  • CrossRef,
  • CAS,
  • Web of Science®
• Johnson IT. 2004. New approaches to the role of diet in the prevention of cancers of the alimentary tract. Mut Res 551:9–28.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 37
• Jung KH, Kim MJ, Ha E, Uhm YK, Kim HK, Chung JH, Yim SV. 2006. Suppressive effect of Punica granatum on the production of tumor necrosis factor (Tnf) in BV2 microglial cells. Biol Pharm Bull 29:1258–61.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 3
• Kandra L, Gyemant G, Zajacz A, Batta G. 2004. Inhibitory effects of tannin on human salivary α-amylase. Biochem Biophys Res Commun 319:1265–71.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 27
• Katz SR, Newman RA, Lansky EP. 2007. Punica granatum: heuristic treatment for diabetes mellitus. J Med Food 10(2):213–7.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 3
• Kaur G, Jabbar Z, Athar M, Alam MS. 2006. Punica granatum (pomegranate) flower extract possesses potent antioxidant activity and abrogates Fe-NTA-induced hepatotoxicity in mice. Food Chem Toxicol 44(7):984–93.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 22
• Kelly AF, Naughton DP, Fielder MD, Gould SWJ, El Sankary W. 2009. Antimicrobial pomegranate rind extracts: enhancement by Cu(II) and vitamin C combinations against clinical isolates of Pseudomonas aeruginosa. Br J Biomed Sci 66(3):129–32.
  • PubMed,
  • Web of Science® Times Cited: 2
• Kim ND, Mehta R, Yu W, Neeman I, Livney T, Amichay A, Poirier D, Nicholls P, Kirby A, Jiang W, Mansel R, Ramachandran C, Rabi T, Kaplan B, Lansky E. 2002. Chemopreventive and adjuvant therapeutic potential of pomegranate (Punica granatum) for human breast cancer. Breast Can Res Treat 71:203–17.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 79
• Kohno H, Suzuki R, Yasui Y, Hosokawa M, Miyashita K, Tanaka T. 2004. Pomegranate seed oil rich in conjugated linolenic acid suppresses chemically induced colon carcinogenesis in rats. Cancer Sci 95(6):481–6.
  Direct Link:

  • Abstract
  • PDF(200K)
  • References
  • Web of Science® Times Cited: 48
• Kong JM, Chia LS, Goh NK, Chia TF, Brouillard R. 2003. Analysis and biological activities of anthocyanins. Phytochem 64(5):923–33.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 180
• Koyama S, Cobb LJ, Mehta HH, Seeram NP, Heber D, Pantuck AJ, Cohen P. 2010. Pomegranate extract induces apoptosis in human prostate cancer cells by modulation of the IGF-IGFBP axis. Growth Horm IGF Res 20(1):55–62.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science®
• Kulkarni AP, Aradhya SM, Divakar S. 2003. Isolation and identification of a radical scavenging antioxidant-punicalagin from pith and carpellary membrane of pomegranate fruit. Food Chem 87(4):551–7.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 38
• Lan J, Lei F, Hua L, Wang Y, Xing D, Du L. 2009. Transport behavior of ellagic acid of pomegranate leaf tannins and its correlation with total cholesterol alteration in HepG2 cells. Biomed Chromatogr 23:531–6.
  Direct Link:

  • Abstract
  • Full Article (HTML)
  • PDF(188K)
  • References
  • Web of Science®
• Lansky EP. Newman RA. 2007. Punica granatum (pomegranate) and its potential for prevention and treatment of inflammation and cancer. J Ethnopharmacol 109:177–206.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 65
• Lansky EP, Jiang W, Mo H, Bravo L, Froom P, Yu W, Harris NM, Neeman I, Campbell MJ. 2005a. Possible synergistic prostate cancer suppression by anatomically discrete pomegranate fractions. Invest New Drugs 23:11–20.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 34
• Lansky EP, Harrison G, Froom P, Jiang WG. 2005b. Pomegranate (Punica granatum) pure chemicals show possible synergistic inhibition of human PC-3 prostate cancer cell invasion across Matrigel™. Invest New Drugs 23:121–2.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 25
• Larrosa M, González-Sarrías A, Yáñez-Gascón MJ, Selma MV, Azorín-Ortuño M, Toti S, Tomás-Barberán F, Dolara P, Espina JC. 2010. Anti-inflammatory properties of a pomegranate extract and its metabolite urolithin-A in a colitis rat model and the effect of colon inflammation on phenolic metabolism. J Nut Biochem 21(8):717–25.
  • CrossRef,
  • CAS,
  • Web of Science®
• Lavker RM. 1995. Cutaneous aging: chronologic versus photoaging. In: GilchrestBA, editor. Photodamage. Cambridge , Mass. : Blackwell Science. p 123–35.
• Lee CJ, Chen LG, Liang WL, Wanga CC. 2010. Anti-inflammatory effects of Punica granatum Linne in vitro and in vivo. Food Chem 118:315–22.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 1
• Lei F, Zhang XN, Wang W, Xing DM, Xie WD, Su H, Du LJ. 2007. Evidence of anti-obesity effects of pomegranate leaf extract in high-fat-diet-induced obese mice. Int J Obes 31(6):1023–9.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 14
• Li Y, Wen S, Kota BP, Peng G, Li GQ, Yamahara J, Roufogalis BD. 2005. Punica granatum flower extract, a potent alpha-glucosidase inhibitor, improves postprandial hyperglycemia in Zucker diabetic fatty rats. J Ethnopharmacol 99:239–44.
  • CrossRef,
  • PubMed,
  • Web of Science® Times Cited: 28
• Li Y, Guo C, Yang J, Wei J, Xu J, Cheng S. 2006. Evaluation of antioxidant properties of pomegranate peel extract in comparison with pomegranate pulp extract. Food Chem 96(2):254–60.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 48
• Li Y, Qi Y, Huang THW, Yamahara J, Roufogalis BD. 2008. Pomegranate flower: a unique traditional antidiabetic medicine with dual PPAR-α/-γ activator properties. Diab Obes Meta 10(1):10–7.
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 4
• Longtin R. 2003. The pomegranate: nature’s power fruit? J Natl Cancer Inst 95:346–8.
  • CrossRef,
  • PubMed,
  • Web of Science® Times Cited: 28
• López AD, Mathers CD, Ezzati M, Jamison DT, Murray CJ. 2006. Global and regional burden of disease and risk factors, 2001: systematic analysis of population health data. Lancet 367:1747–57.
  • CrossRef,
  • PubMed,
  • Web of Science® Times Cited: 664
• Lu R, Hu F, He Y. 2003. Free radical scavenging activity of the fresh leaves of some shade trees. Daxue Xuebao 30:193–6.
  • CAS
• Machado TB, Leal ICR, Amaral ACF, Dos Santos KRN, Da Silva MG, Kuster RM. 2002. Antimicrobial ellagitannin of Punica granatum fruits. J Braz Chem Soc 13(5):606–10.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 36
• Mackay J, Mensah G. 2004. The atlas of heart disease and stroke. Geneva , Switzerland : World Health Org.
• Madlener S, Illmer C, Horvath Z, Saiko P, Losert A, Herbacek I, Grusch M, Elford HL, Krupitza G, Bernhaus A, Fritzer-Szekeres M, Szekeres T. 2007. Gallic acid inhibits ribonucleotide reductase and cyclooxygenases in human HL-60 promyelocytic leukemia cells. Cancer Lett 245:156–62.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 16
• Madrigal-Carballo S, Rodriguez G, Krueger CG, Dreher M, Reed JD. 2009. Pomegranate (Punica granatum L.) supplements: authenticity, antioxidant and polyphenol composition. J Funct Foods 1:324–9.
  • CrossRef,
  • Web of Science® Times Cited: 3
• Malik A, Afaq F, Sarfaraz S, Adhami VM, Syed DN, Mukhtar H. 2005. Pomegranate fruit juice for chemoprevention and chemotherapy of prostate cancer. Proc Natl Acad Sci 102(41):14813–8.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 77,
  • ADS
• Marín FR, Martínez M, Uribesalgo T, Castillo S, Frutos MJ. 2001. Changes in nutraceutical composition of lemon juices according to different industrial extraction systems. Food Chem 78:319–24.
  • CrossRef,
  • Web of Science® Times Cited: 14
• Martínez JJ, Melgarejo P, Hernández F, Salazar DM, Martínez R. 2006. Seed characterisation of five new pomegranate (Punica granatum L.) varieties. Sci Hortic 110:241–6.
  • CrossRef,
  • Web of Science® Times Cited: 6
• Mathabe MC, Nikolova RV, Lall N, Nyazema NZ. 2005. Antibacterial activities of medicinal plants used for the treatment of diarrhoea in Limpopo Province, South Africa. J Ethnopharmacol 105:286–93.
  • CrossRef,
  • PubMed,
  • Web of Science® Times Cited: 21
• Matsui T, Ebuchi S, Kobayashi M, Fukui K, Sugita K, Terahara N, Matsumoto K. 2002. Anti-hyperglycemic effect of diacylated anthocyanin derived from Ipomoea batatas cultivar Ayamurasaki can be achieved through the alpha-glucosidase inhibitory action. J Agric Food Chem 50:7244–8.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 61
• McCarrell EM, Gould SWJ, Fielder MD, Kelly AF, El-Sankary W, Naughton DP. 2008. Antimicrobial activities of pomegranate rind extracts: enhancement by addition of metal salts and vitamin C. BMC Comple Alter Med 8:64.
  • CrossRef,
  • PubMed,
  • Web of Science® Times Cited: 4
• Meerts IATM, Verspeek-Rip CM, Buskens CAF, Keizer HG, Bassaganya-Riera J, Jouni ZE, Van Huygevoort AHBM, Van Otterdijk FM, Van De Waart EJ. 2009. Toxicological evaluation of pomegranate seed oil. Food Chem Toxicol 47(6):1085–92.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 1
• Melendez PA, Capriles VA. 2006. Antibacterial properties of tropical plants from Puerto Rico. Phytomed 13:272–6.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 10
• Menezes SM, Cordeiro LN, Viana GS. 2006. Punica granatum (pomegranate) extract is active against dental plaque. J Herb Pharmacother 6(2):79–92.
  • CrossRef,
  • PubMed
• Mertens-Talcott SU, Jilma-Stohlawetz P, Rios J, Hingorani L, Derendorf H. 2006. Absorption, metabolism, and antioxidant effects of pomegranate (Punica granatum L.) polyphenols after ingestion of a standardized extract in healthy human volunteers. J Agric Food Chem 54:8956–61.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 32
• Miguel MG, Dandlen S, Neves MA. 2009. Antioxidant activities of flower extract and pomegranate juice. Acta Hort 818:389–94.
• Mirdehghan SH, Rahemi M. 2007. Seasonal changes of mineral nutrients and phenolics in pomegranate (Punica granatum L.) fruit. Sci Hort 111(2):120–7.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 6
• Mousavinejad G, Emam-Djomeh Z, Rezaei K, Khodaparast MHH. 2009. Identification and quantification of phenolic compounds and their effects on antioxidant activity in pomegranate juices of eight Iranian cultivars. Food Chem 115:1274–8.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 4
• Muangsan N, Senamontee V. 2008. Antimicrobial effects of some medicinal plant extracts against bacteria associated with black disease. Acta Hort 786:73–6.
  • Web of Science® Times Cited: 2
• Murthy KNC, Jayaprakasha GK, Singh RP. 2002. Studies on antioxidant activity of pomegranate (Punica granatum) peel extract using in vivo models. J Agric Food Chem 50(17):4791–5.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 40
• Nascimento GGF, Locatelli J, Freitas PC, Silva GL. 2000. Antibacterial activity of plant extracts and pyhtochemicals on antibiotic-resistant bacteria. Brazilian J Microbiol 31:247–56.
  • CrossRef,
  • Web of Science® Times Cited: 125
• Naveena BM, Sen AR, Kingsly RP, Singh DB, Kondaiah N. 2008. Antioxidant activity of pomegranate rind powder extract in cooked chicken patties. Int J Food Sci Technol 43:1807–12.
  Direct Link:

  • Abstract
  • Full Article (HTML)
  • PDF(177K)
  • References
  • Web of Science® Times Cited: 4
• Naz S, Siddiqi R, Ahmad S, Rasool S, Sayeed S. 2007. Antibacterial activity directed isolation of compounds from Punica granatum. J Food Sci 72:341–5.
  Direct Link:

  • Abstract
  • Full Article (HTML)
  • PDF(503K)
  • References
  • Web of Science® Times Cited: 2
• Negi PS, Jayaprakasha GK. 2003. Antioxidant and antibacterial activities of Punica granatum peel extracts. J Food Sci 68:1473–7.
  Direct Link:

  • Abstract
  • PDF(487K)
  • References
  • Web of Science® Times Cited: 30
• Negi PS, Jayaprakasha GK, Jena BS. 2003. Antioxidant and antimutagenic activities of pomegranate peel extracts. Food Chem 80(3):393–7.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 56
• Neuhofer H, Witte L, Gorunovic M, Czygan FC. 1993. Alkaloids in the bark of Punica granatum L. (pomegranate) from Yugoslavia. Pharmazie 48:389–91.
  • Web of Science® Times Cited: 7
• Neurath AR, Strick N, Li YY, Debnath AK. 2005. Punica granatum (pomegranate) juice provides an HIV-1 entry inhibitor and candidate topical microbicide. Ann NYA Cad Sci 1056:311–27.
  Direct Link:

  • Abstract
  • Full Article (HTML)
  • PDF(660K)
  • References
  • Web of Science® Times Cited: 5
• Niva M. 2007. “All foods affect health”: understandings of functional foods and healthy eating among health-oriented Finns. Appetite 48:384–93.
  • CrossRef,
  • PubMed,
  • Web of Science® Times Cited: 15
• Noda Y, Kaneyuka T, Mori A, Packer L. 2002. Antioxidant activities of pomegranate fruit extract and its anthocyanidins: delphinidin, cyanidin, and pelargonidin. J Agric Food Chem 50:166–71.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 105
• Nomura Y, Tamaki Y, Tanaka T, Arakawa H, Tsurumoto A, Kirimura K, Sato T, Hanada N, Kamoi K. 2006. Screening of periodontitis with salivary enzyme tests. J Oral Sci 48:177–83.
  • CrossRef,
  • PubMed,
  • CAS
• Ohno T, Kato N, Ishii C, Shimizu M, Ito Y, Tomono S, Kawazu S. 1993. Genistein augments cyclic adenosine 3’5’-monophosphate (CAMP) accumulation and insulin release in MIN6 cells. Endocr Res 19:273–85.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 30
• Okonogi S, Duangrat C, Anuchpreeda S, Tachakittirungrod S, Chowwanapoonpohn S. 2007. Comparison of antioxidant capacities and cytotoxicities of certain fruit peels. Food Chem 103(3):839–46.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 17
• Olapour S, Mousavi E, Sheikhzade M, Hoseininezhad O, Najafzadeh H. 2009. Evaluation antidiarrheal effects of pomegranate peel extract. J Iran Chem Soc 6(Nov):115–43.
• Orak HH. 2009. Evaluation of antioxidant activity, colour and some nutritional characteristics of pomegranate (Punica granatum L.) juice and its sour concentrate processed by conventional evaporation. Int J Food Sci Nutr 60(1):1–11.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 2
• Opara LU, Majeed R, Al-Ani MR, Al-Shuaibi YS. 2009. Physico-chemical properties, vitamin C content, and antimicrobial properties of pomegranate fruit (Punica granatum L.). Food Bioprocess Technol 2(3):315–21.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 5
• Ozgen M, Durgaç C, Serçe S, Kaya C. 2008. Chemical and antioxidant properties of pomegranate cultivars grown in the Mediterranean region of Turkey. Food Chem 11(3):703–6.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 8
• Ozgul-Yucel S. 2005. Determination of conjugated linolenic acid content of selected oil seeds grown in Turkey. J Am Oil Chem Soc 82(12):893–7.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 14
• Pacheco-Palencia LA, Noratto G, Hingorani L, Talcott ST, Mertens-Talcott SU. 2008. Protective effects of standardized pomegranate (Punica granatum L.) polyphenolic extract in ultraviolet-irradiated human skin fibroblasts. J Agric Food Chem 56:8434–41.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 7
• Palou A, Serra F, Pico C. 2003. General aspects on the assessment of functional foods in the European Union. Eur J Clin Nutr 57:12–7.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 14
• Pantuck AJ, Leppert JT, Zomorodian N, Aronson W, Hong J, Barnard RJ, Seeram N, Liker H, Wang H, Elashoff R, Heber D, Aviram M, Ignarro L, Belldegrun A. 2006. Phase II study of pomegranate juice for men with rising prostate-specific antigen following surgery or radiation for prostate cancer. Clin Cancer Res 12:4018–26.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 63
• Parashar A, Gupta C, Gupta SK, Kumar A. 2009. Antimicrobial ellagitannin from pomegranate (Punica granatum) fruits. Int J Fruit Sci 9(3):226–31.
  • CrossRef
• Parmar HS, Kar A. 2007. Antidiabetic potential of Citrus sinensis and Punica granatum peel extracts in alloxan-treated male mice. BioFac 31(1):17–24.
  Direct Link:

  • Abstract
  • PDF(79K)
  • References
  • Web of Science® Times Cited: 5
• Pasha C, Sayeed S, Ali S, Khan Z. 2009. Antisalmonella activity of selected medicinal plants. Turk J Biol 33:59–64.
  • Web of Science® Times Cited: 2
• Patel C, Dadhaniya P, Hingorani L, Soni MG. 2008. Safety assessment of pomegranate fruit extract: acute and subchronic toxicity studies. Food Chem Toxicol 46:2728–35.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 3
• Pérez C, Anesini C. 1994. In vitro antibacterial activity of Argentinian folk medicinal plants against Salmonella typhi. J Ethnopharmacol 44:41–6.
  • CrossRef,
  • PubMed,
  • Web of Science® Times Cited: 16
• Pérez-Alvarez JA. 2008. Los alimentos del bienestar: alimentación del siglo XXI. IAlimentos 3:54.
• Pérez-Alvarez JA, Sayas-Barberá E, Fernández-López J. 2003. Aspectos generales de los alimentos funcionales. In: Pérez-AlvarezJA, Sayas-BarberáE, Fernández-LópezJ, editors. Alimentos funcionales y dieta Mediterránea. Elche : Univ. Miguel Hernández. p 31–8.
• Pérez-Vicente A, Gil-Izquierdo A, Garcia-Viguera C. 2002. In vitro gastrointestinal digestion study of pomegranate juice phenolic compounds, anthocyanins, and vitamin C. J Agric Food Chem 50:2308–12.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 45
• Petti S, Scully C. 2009. Polyphenols, oral health and disease: a review. J Dent 37:413–23.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 10
• Pillai NR. 1992. Anti-diarrhoeal activity of Punica granatum in experimental animals. Int J Pharmaco 30(3):201–4.
  • CrossRef
• Pin-Der D. 1998. Antioxidant activity of burdock (Arctium lappa L.): its scavenging effects on free radical and active oxygen. J Am Oil Chem Soc 75:455–61.
  • CrossRef,
  • Web of Science® Times Cited: 136
• Plumb GW, De Pascual-Teresa S, Santos-Buelga C, Rivas-Gonzalo JC, Williamson G. 2002. Antioxidant properties of gallocatechin and prodelphinidins from pomegranate peel. Redox Report 7:41–6.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 12
• Poyrazoglu E, Gökmen V, Artιk N. 2002. Organic acids and phenolic compounds in pomegranates (Punica granatum L.) grown in Turkey. J Food Comp Anal 15:567–75.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 40
• Prashanth DJ, Asha MK, Amit A. 2001. Antibacterial activity of Punica granatum. Fitoterapia 72:171–3.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 32
• Puupponen-Pimia R, Nohynek L, Meier C, Kahkonen M, Heinonen M, Hopia A, Oksman-Caldentey KM. 2001. Antimicrobial properties of phenolic compounds from berries. J Appl Microbiol 90:494–507.
  Direct Link:

  • Abstract
  • Full Article (HTML)
  • PDF(4250K)
  • References
  • Web of Science® Times Cited: 128
• Puupponen-Pimia R, Nohynek L, Hartmann-Schmidlin S, Kahkonen M, Heinonen M, Maatta-Riihinen K, Oksman-Caldentey KM. 2005. Berry phenolics selectively inhibit the growth of intestinal pathogens. J Appl Microbiol 98:991–1000.
  Direct Link:

  • Abstract
  • Full Article (HTML)
  • PDF(153K)
  • References
  • Web of Science® Times Cited: 48
• Qnais EY, Elokda AS, Abu-Ghalyun YY, Abdulla FA. 2007. Antidiarrheal activity of the aqueous extract of Punica granatum (pomegranate) peels. Pharma Biol 45(9):715–20.
  • CrossRef,
  • Web of Science® Times Cited: 1
• Raybaudi-Massilia RM, Mosqueda-Melgar J, Soliva-Fortuny R, Martín-Belloso O. 2009. Control of pathogenic and spoilage microorganisms in fresh-cut fruits and fruit juices by traditional and alternative natural antimicrobials. Comp Rev Food Sci Food Safety 8:157–80.
  Direct Link:

  • Abstract
  • Full Article (HTML)
  • PDF(540K)
  • References
  • Web of Science® Times Cited: 4
• Reddy MK, Gupta SK, Jacob MR, Khan SI, Ferreira D. 2007. Antioxidant, antimalarial and antimicrobial activities of tannin-rich fractions, ellagitannins and phenolic acids from Punica granatum L. Planta Med 73:461–7.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 29
• Ricci D, Giamperi L, Bucchini A, Fraternale D. 2006. Antioxidant activity of Punica granatum fruits. Fitoterapia 77:310–2.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 12
• Roberfroid MB. 2002. Global view on functional foods: European perspectives. Br J Nut 88:133–8.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 19
• Romier-Crouzet B, Walle JV, During A, Joly A, Rousseau C, Henry O, Larondelle Y, Schneider YJ. 2009. Inhibition of inflammatory mediators by polyphenolic plant extracts in human intestinal Caco-2 cells. Food Chem Toxicol 47:1221–30.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 4
• Rosenblat M, Volkova N, Coleman R, Aviram M. 2006a. Pomegranate by-product administration to apolipoprotein e-deficient mice attenuates atherosclerosis development as a result of decreased macrophage oxidative stress and reduced cellular uptake of oxidized low-density lipoprotein. J Agric Food Chem 54:1928–35.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 18
• Rosenblat M, Aviram M. 2006b. Anti-oxidative properties of pomegranate: In vitro studies. In: SeeramNP, HeberD, editors. Pomegranates: ancient roots to modern medicine. New York : Taylor and Francis Group. p 31–43.
• Rosenblat M, Hayek T, Aviram M. 2006c. Anti-oxidative effects of pomegranate juice (PJ) consumption by diabetic patients on serum and on macrophages. Atherosclerosis 187:363–71.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 40
• Rout S, Banerjee R. 2007. Free radical scavenging, anti-glycation and tyrosinase inhibition properties of a polysaccharide fraction isolated from the rind from Punica granatum. Biores Technol 98(16):3159–63.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 12
• Russo F, Chimienti G, Riezzo G, Pepe G, Petrosillo G, Chiloiro M, Marconi E. 2008. Inulin-enriched pasta affects lipid profile and Lp(a) concentrations in Italian young healthy male volunteers. Eur J Nutr 47(8):453–9.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 2
• Sadeghi N, Jannat B, Oveisi MR, Hajimahmoodi M, Photovat M. 2009. Antioxidant activity of Iranian pomegranate (Punica granatum L.) seed extracts. J Agric Sci Technol 11:633–8.
  • Web of Science® Times Cited: 2
• Sakagami Y, Murata H, Nakanishi T, Inatomi Y, Watabe K, Iinuma M, Tanaka T, Murata J, Long FA. 2001. Inhibitory effect of plant extracts on production of verotoxin by enterohemorrhagic Escherichia coli O157:H7. J Health Sci 47:473–7.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 8
• Salgado L, Melgarejo P, Meseguer I, Sánchez M. 2009. Antimicrobial activity of crude extracts from pomegranate (Punica granatum L.). Acta Hort 818:257–64.
• Sassano G, Sanderson P, Franx J, Groot P, Van Straalen J, Bassaganya-Riera J. 2009. Analysis of pomegranate seed oil for the presence of jacaric acid. J Sci Food Agric 89:1046–52.
  Direct Link:

  • Abstract
  • Full Article (HTML)
  • PDF(218K)
  • References
  • Web of Science® Times Cited: 1
• Sastravaha G, Gassmann G, Sangtherapitikul P, Grimm WD. 2005. Adjunctive periodontal treatment with Centella asiatica and Punica granatum extracts in supportive periodontal therapy. J Int Acad Periodontol 7:70–9.
  • PubMed
• Scalbert A, Manach C, Morand C, Rémésy C, Jiménez L. 2005. Dietary polyphenols and the prevention of diseases. Crit Rev Food Sci Nut 45:287–306.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 291
• Scannapieco FA, Torres G, Levine MJ. 1993. Salivary a-amylase: role in dental plaque and caries formation. Crit Rev Oral Biol Med 4:301–7.
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 54
• Schubert SY, Neeman I, Resnick N. 2002. A novel mechanism for the inhibition of NFkB activation in vascular endothelial cells by natural antioxidants. FASEB J 16:1931–3.
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 58
• Science Direct. 2010. http://www.sciencedirect.com . Accesed Apr 2010.
• Seeram NP, Lee R, Heber D. 2004. Bioavailability of ellagic acid in human plasma after consumption of ellagitannins from pomegranate (Punica granatum L.) juice. Clin Chim Acta 348:63–8.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 65
• Seeram N, Lee R, Hardy M, Heber D. 2005a. Rapid large-scale purification of ellagitannins from pomegranate husk, a by-product of the commercial juice industry. Sep Purif Technol 41:49–55.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 39
• Seeram NP, Adams LS, Henning SM, Niu Y, Zhang Y, Nair MG, Heber D. 2005b. In vitro antiproliferative, apoptotic and antioxidant activities of punicalagin, ellagic acid and a total pomegranate tannin extract are enhanced in combination with other polyphenols as found in pomegranate juice. J Nut Biochem 16:360–7.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 130
• Seeram NP, Henning SM, Zhang Y, Suchard M, Li Z, Heber D. 2006. Pomegranate juice ellagitannin metabolites are present in human plasma and some persist in urine for up to 48 h. J Nutr 136:2481–5.
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 38
• Seeram NP, Zhang Y, McKeever R, Henning SM, Lee RP, Suchard MA, Li Z, Chen S, Thames G, Zerlin A, Nguyen M, Wang D, Dreher M, Heber D. 2008a. Pomegranate juice and extracts provide similar levels of plasma and urinary ellagitannin metabolites in human subjects. J Med Food 11(2):390–4.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 6
• Seeram NP, Aviram M, Zhang Y, Henning SM, Feng L, Dreher M, Heber D. 2008b. Comparison of antioxidant potency of commonly consumed polyphenol-rich beverages in the United States. J Agric Food Chem 56(4):1415–22.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 41
• Sezer ED, Akçay YD, İlanbey B, Yıldırım HK, Sözmen EY. 2007. Pomegranate wine has greater protection capacity than red wine on low-density lipoprotein oxidation. J Med Food 10(2):371–4.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 1
• Shukla M, Gupta K, Rasheed Z, Khan KA, Haqqi TM. 2008. Consumption of hydrolyzable tannins-rich pomegranate extract suppresses inflammation and joint damage in rheumatoid arthritis. Nutr 24:733–43.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 6
• Sicree R, Shaw JE, Zimmet PZ. 2003. The global burden of diabetes. In: GanD, editor. Diabetes atlas. 2nd ed. Brussels : Intl. Diabetes Federation. p 15–71.
• Singh RP, Murthy KNC, Jayaprakasha GK. 2002. Studies on the antioxidant activity of pomegranate peel and seed extracts using in vitro models. J Agric Food Chem 50:81–6.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 179
• Singh M, Arseneault M, Sanderson T, Morthy V, Ramassamy C. 2008. Challenges for research on polyphenols from foods in Alzheimer’s disease: bioavailability, metabolism and cellular and molecular mechanism. J Agric Food Chem 56:4855–73.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 32
• Song JM, Lee KH, Seong BL. 2005. Antiviral effect of catechins in green tea on influenza virus. Antiviral Res 68(2):66–74.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 64
• Soobrattee MA, Neergheen VS, Luximon-Ramma A, Aruoma OI, Bahorun T. 2005. Phenolics as potential antioxidant therapeutic agents: mechanism and actions. Mutation Res 579:200–13.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 143
• Sumner MD, Elliott-Eller M, Weidner G, Daubenmeier JJ, Chew MH, Marlin R, Raisin CJ, Ornish D. 2005. Effects of pomegranate juice consumption on myocardial perfusion in patients with coronary heart disease. Am J Cardiol 96(6):810–4.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 33
• Surveswaran S, Cai YZ, Corke H, Sun M. 2007. Systematic evaluation of natural phenolic antioxidants from 133 Indian medicinal plants. Food Chem 102:938–53.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 37
• Syed DN, Malik A, Hadi N, Sarfaraz S, Afaq F, Mukhtar H. 2006. Photo-chemopreventive effect of pomegranate fruit extract on UVA-mediated activation of cellular pathways in normal human epidermal keratinocytes. Photochem Photobiol 82(2):398–405.
  Direct Link:

  • Abstract
  • Full Article (HTML)
  • PDF(1055K)
  • References
  • Web of Science® Times Cited: 22
• Syed DN, Afaq F, Mukhtar H. 2007. Pomegranate derived products for cancer chemoprevention. Sem Cancer Biol 17:377–85.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 12
• Szkudelski T. 2001.The mechanism of alloxan and streptozotocin action in β cells of the rat pancreas. Physiol Res 50:536–46.
• Tanaka T, Sugie S. 2008. Inhibition of colon carcinogenesis by dietary non-nutritive compounds. J Toxicol Pathol 20(4):215–35.
  • CrossRef
• Tezcan F, Gültekin-Özgüven M, Diken T, Özçelik B, Erim FB. 2009. Antioxidant activity and total phenolic, organic acid and sugar content in commercial pomegranate juices. Food Chem 115(3):873–7.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 5
• Toi M, Bando H, Ramachandran C, Melnick SJ, Imai A, Fife RS, Carr RE, Oikawa T, Lansky EP. 2003. Preliminary studies on the anti-angiogenic potential of pomegranate fractions in vitro and in vivo. Angiogenesis 6:121–8.
  • CrossRef,
  • PubMed,
  • CAS
• Türk G, Sönmez M, Aydin M, Yüce A, Gür S, Yüksel M, Aksu EH, Aksoy H. 2008. Effects of pomegranate juice consumption on sperm quality, spermatogenic cell density, antioxidant activity and testosterone level in male rats. Clin Nut 27(2):289–96.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 6
• Türk G, Sönmez M, Çeribasi AO, Yüce A, Atessahin A. 2010. Attenuation of cyclosporine A-induced testicular and spermatozoal damages associated with oxidative stress by ellagic acid. Int Immunopharmacol 10(2):177–82.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science®
• Tzulker R, Glazer I, Bar-Ilan I, Holland D, Aviram M, Amir R. 2007. Antioxidant activity, polyphenol content and related compounds in different fruit juices and homogenates prepared from 29 different pomegranate accessions. J Agric Food Chem 55:9559–70.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 22
• Valko M, Leibfritz D, Moncol J, Cronin MT, Mazur M, Telser J. 2007. Free radicals and antioxidants in normal physiological functions and human disease. Int J Biochem Cell Biol 39:44–84.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 847
• Van Elswijk DA, Schobel UP, Lansky EP, Irth H, Van Der Greef J. 2004. Rapid dereplication of estrogenic compounds in pomegranate (Punica granatum) using on-line biochemical detection coupled to mass spectrometry. Phytochem 65(2):233–41.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 30
• Vasconcelos LC, Sampaio MC, Sampaio FC, Higino JC. 2003. Use of Punica granatum as an antifungal agent against candidosis associated with denture stomatitis. Mycoses 46(5–6):192–6.
  Direct Link:

  • Abstract
  • Full Article (HTML)
  • PDF(92K)
  • References
  • Web of Science® Times Cited: 8
• Veldhuizen EJ, Tjeerdsma-van Bokhoven JL, Zweijtzer C, Burt SA, Haagsman HP. 2006. Structural requirements for the antimicrobial activity of carvacrol. J Agric Food Chem 54:1874–9.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 15
• Vidal A, Fallarero A, Pena BR, Medina ME, Gra B, Rivera F, Gutierrez Y, Vuorela PM. 2003. Studies on the toxicity of Punica granatum L. (Punicaceae) whole fruit extracts. J Ethnopharmacol 89:295–300.
  • CrossRef,
  • PubMed,
  • Web of Science® Times Cited: 22
• Viuda-Martos M, Ruiz-Navajas Y, Fernández-López J, Pérez-Alvarez JA. 2008. Antifungal activity of lemon (Citrus lemon L.), mandarin (Citrus reticulata L.), grapefruit (Citrus paradisi L.) and orange (Citrus sinensis L.) essential oils. Food Control 19:1130–8.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 10
• Viuda-Martos M, Ruiz-Navajas Y, Fernández-Lopez J, Pérez-Alvarez JA. 2010a. Spices as functional foods: a review. Crit Rev Food Sci Nut In Press.
  • CrossRef,
  • Web of Science® Times Cited: 2
• Viuda-Martos M, López-Marcos MC, Fernández-Lopez J, Sendra E, Sayas-Barberá E, López-Vargas JH, Pérez-Alvarez JA. 2010b. The role of fiber in cardiovascular diseases: a review. Comp Rev Food Sci Food Safety 9:240–58.
  Direct Link:

  • Abstract
  • Full Article (HTML)
  • PDF(581K)
  • References
  • Web of Science® Times Cited: 2
• Voravuthikunchai S, Lortheeranuwat A, Jeeju W, Sririrak T, Phongpaichit S, Supawita T. 2004. Effective medicinal plants against enterohaemorrhagic Escherichia coli O157:H7. J Ethnopharmacol 94:49–54.
  • CrossRef,
  • PubMed,
  • Web of Science® Times Cited: 45
• Voravuthikunchai SP. Sririrak T, Limsuwan S, Supawita T, Iida T, Honda T. 2005. Inhibitory effects of active compounds from Punica granatum pericarp on verocytotoxin production by enterohemorrhagic Escherichia coli O157:H7. J Health Sci 51(5):590–6.
  • CrossRef,
  • CAS,
  • Web of Science® Times Cited: 1
• Walle T, Browning AM, Steed LL, Reed SG, Walle UK. 2005. Flavonoid glucosides are hydrolyzed and thus activated in the oral cavity in humans. J Nutr 135:48–52.
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 45
• Waltner-Law ME, Wang XL, Law BK, Hall RK, Nawano M, Granner DK. 2002. Epigallocatechin gallate, a constituent of green tea, represses hepatic glucose production. J Biol Chem 277:34933–40.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 143
• Widmer R, Ziaja I, Grune T. 2006. Protein oxidation and degradation during aging: Role in skin aging and neurodegeneration. Free Radical Res 40(12):1259–68.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 18
• Wu Q, Koponen J, Mykamen H, Torronen A. 2007. Berry phenolic extracts modulate the expression of p21WAF1 and Bax but not Bcl-2 in HT-29 colon cancer cells. J Agric Food Chem 55:1156–63.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 14
• Xu S, Touyz RM. 2006. Reactive oxygen species and vascular remodeling in hypertension: still alive. Can J Cardiol 22(11):947–51.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 17
• Xu KZY, Zhu C, Kim MS, Yamahara J, Li Y. 2009. Pomegranate flower ameliorates fatty liver in an animal model of type 2 diabetes and obesity. J Ethnopharmacol 123(2):280–7.
  • CrossRef,
  • PubMed,
  • Web of Science®
• Yoshimura M, Watanabe Y, Kasai K, Yamakoshi J, Koga T. 2005. Inhibitory effect of an ellagic acid-rich pomegranate extracts on tyrosinase activity and ultraviolet-induced pigmentation. Biosci Biotechnol Biochem 69(12):2368–73.
  • CrossRef,
  • PubMed,
  • CAS,
  • Web of Science® Times Cited: 26
• Zhang LH, Li LL, Li YX, Zhang YH. 2008. In vitro antioxidant activities of fruits and leaves of pomegranate. Acta Hort 765:31–4.
  • CAS